Transcript asmbl_49682

Sequence
Transcript Sequence for observation asmbl_49682 of TGE0005877:
CAGAGAAAACTAGGAAGATCCTGACGGAGTTCCTTCGTTTTTACGAGGACCAGTATGGTGTCGCCCTTTTCAACAGCATGCGCCACGAAATCGAGGGCACCGGGGTGCCGCAGGCCCAGCTGCTCTGGCGCAAGGTGCCGCTGGATGAGCGCATCATCTTCTCGGGGAACCTCTTCCAGCACCAGGAGGACAACAAGAAGTGGAGGAACCGCTTCAGCCTCGTGCCCCACAACTATGGGCTGGTTCTCTACGAGAACAAAGTGGCGTATGAGCGGCAGGTCCCACCCCGAGCTGTCATCAACAGCGCAGGCTACAAAATCCTCACATCCGTGGACCAGTACCTGGAGCTCGTTGGCAACTCCTTACCAGGGACCACCTCGAAATCGGGCTCCGCCCCCATCCTCAAGTGCCCCACGCAGTTCCCACTCATCCTCTGGCATCCTTCTGCACGACACTACTACTTCTGCATGATGACAGAAGCCGAGCAGGACAAGTGGCAGGCTGTCCTGCAGGACTGCATCCGGCACTGCAACAACGGGATCCCCGAGGACTCCAAGGTGGAGGGCCCTGCGTTCACGGACGCCATTCGCATGTACCGCCAGTCGAAGGAGCTGTATGGCACCTGGGAGATGCTGTGTGGCAACGAGGTGCAGATCCTGAGCAACCTGGTGATGGAGGAGCTGGGCCCTGAGCTGAAGGCGGAACTTGGCCCCCGGCTGAAGGGGAAACCACAGGAGCGGCAGCGGCAGTGGATCCAGATCTCGGATGCTGTGTACCGCATGGTGTACGAGCAGGCCGCAGCGCAGTTTGAGGCGGTGCTGTCCAAGCTGCAGCTGGCCCGGCCGGCCATGGAGGCGGTCATCCGCACCGACATGGACCAGATCATCACCTCCAAGGAGCATCTGGCCAGCAAGATCCGAGCCTTCATTCTCCCCAAGGCGGAGGTGTGTGTCCGGAACCACGTTCAGCCCTACATCCCGTCCATCCTGGAGGCCCTCATGGTGCCCACCAGCCAGGGCTTCACGGAGGTGCGGGACGTCTTCTTCAAGGAGGTCACCGACATAAACCTGAACATCATCAATGAGGGCGGCATCGACAAGCTGGGCGAGTACATGGAGAAGCTGTCCCAGCTGGCGTACCACCCCCTCAAGATGCAGAGCTGCTACGAGAAGATGGAGCCGCTGCGGCTTGATGGTCTGCAGCAGCGTTTCGACGTGTCCAGCACGTCCGTGTTCAAGCAGCGAGCCCAGATCCATATGCGTGAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGG