Transcript asmbl_49669

Sequence
Transcript Sequence for observation asmbl_49669 of TGE0005876:
CCCAGACATCAGAGACCTACTGAATTCAGGATTTCGTGAGTGAGAACTGTCAGTAATCTCGGTGCGTTCCCGTCCTTCGGCCTGTGGCTGGATTGCTTGCGACGTCCTATCTACCTGCCTGCTGACTGACTGGCCGACAGCTCCGGCAAGATGAAGCTCTCCCTGGTGGCTGCGGTGCTGCTGCTGCTCGGCGCGGCGCGGGCCGAGGAGGAGGACAAGAAAGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCCTGCGTCGGGGTGTTCAAGAATGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGCATCACGCCGTCTTATGTGGCCTTCACTCCCGAAGGGGAGCGTCTCATCGGGGATGCAGCCAAGAACCAGCTCACGTCCAACCCTGAGAATACGGTCTTCGACGCCAAGCGGCTCATTGGCCGTACTTGGAACGACCCGTCTGTGCAGCAGGACATCAAGTTTTTGCCTTTCAAGGTGGTTGAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGCCAAACAAAGACATTTGCTCCTGAGGAAATTTCCGCCATGGTTCTCACTAAAATGAAGGAAACTGCTGAGGCTTATTTGGGAAAGAAGGTTACTCATGCAGTTGTTACTGTACCGGCCTATTTCAATGATGCCCAACGCCAGGCAACCAAAGATGCTGGAACTATTGCTGGATTGAATGTTATGAGAATCATCAATGAGCCTACAGCAGCTGCTATTGCTTATGGCCTAGATAAGAGAGAAGGGGAGAAGAACATCTTGGTGTTCGACCTGGGTGGTGGAACCTTCGATGTGTCTCTTCTCACCATTGATAATGGTGTCTTCGAAGTTGTGGCTACTAATGGAGATACCCATCTGGGTGGAGAAGACTTTGACCAGCGTGTCATGGAACACTTCATCAAGCTCTACAAAAAGAAGACTGGCAAAGATGTTAGGAAAGACAACAGAGCTGTGCAGAAACTCCGGCGGGAGGTAGAAAAGGCCAAACGGGCCCTGTCTTCTCAACATCAAGCAAGAATTGAAATTGAGTCCTTCTTTGAAGGAGAAGACTTCTCTGAGACCTTGACTCGAGCCAAATTTGAAGAACTAAACATGGACCTGTTCCGTTCTACCATGAAGCCTGTCCAGAAAGTGCTGGAAGATTCTGATTTGAAGAAATCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCTACTCGAATCCCAAAGATCCAACAACTGGTTAAAGAGTTCTTCAATGGCAAGGAGCCATCCCGTGGCATAAACCCAGATGAGGCTGTGGCATATGGTGCTGCTGTCCAGGCTGGTGTACTGTCTGGTGATCAAGATACAGGTGATCTGGTACTGCTTGACGTATGTCCGCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCCAGGAACACTGTGGTGCCCACCAAGAAGTCACAGATCTTTTCTACAGCTTCCGATAATCAACCAACTGTTACAATCAAAGTTTATGAAGGTGAACGACCCCTGACAAAAGACAATCATCTTCTGGGAACTTTTGATCTGACTGGAATCCCTCCTGCTCCCCGTGGAGTCCCACAGATTGAAGTCACTTTTGAGATAGATGTGAATGGCATTCTTCGAGTGACAGCTGAAGACAAAGGTACAGGCAACAAAAATAAGATCACAATTACCAATGACCAAAATCGCCTGACACCCGAAGAGATTGAAAGGATGGTTAATGATGCTGAAAAGTTTGCAGAGGAAGATAAAAAGCTCAAGGAGCGCATTGATACTAGAAATGAATTAGAAAGTTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAAAAGCTGGGGGGCAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCCGTAGAGGAAAAGATTGAATGGCTGGAAAGTCACCAAGATGCTGACATTGAAGATTTCAAAGCTAAAAAGAAGGAACTAGAAGAAATTGTTCAGCCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCTCCCCCAACTGGAGATGAGGAACCAGTAGACAAAGATGAGTTGTAGACACTGCTCTGCTAGTGCTATGATGTTGTAAATACTGGACTCAGGAACTTTCGTTAGGAGAAAATTGAGAGAACTTAAGTCTCGAATGTAATTGGAATCTTCACCTTGGAGTGGAGTTGAAAATGCTATAGCCCAAGTGGCTGTTTACTGCTTTTCGTTAGCAGTTGCTCACATGTCCTGGGGTGGGGGGACAGGAAGAATTGGCTATCTTAAAAAGTGGGTAAAAAGGTTGGGTTACGGCATGTGTTCACCATGGAAAAATGTTCTATTTAACATTTGGGTCATGTGCATCTGGTGTAGGAACTTTATTTTCTACCGTAAGTGACATCAATAAATGTTTGTTATTT