Transcript asmbl_47723

Sequence
Transcript Sequence for observation asmbl_47723 of TGE0005795:
GCGGCTGCCGCGTGACGTGGCACAGCGAAAGGCTTAATACTAGAGCCGGAGCTGCCGCGCCAGTCGTAGAGCAGGTCCGCGCCCCGCTAGTACCTGACCTGGAGCTTAGTCCGAAACGCCGGCTAGCGGGCAGTTCCTGCCGCCGTCTTTCTTCCTTAGCTTCTTTTTCTCGCTCAGTTTGCCGGGAGCTTGGAAGGAGAAGGCCCGGGGACGCTCTGAACCCCTTCTGCTCCTGCCCATCGCAAGTGCCACTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTTGGCAAGAAACAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAGCTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTTACAGTATGGGATGTTGGTGGTCAAGACAAAATAAGGCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAATGATCGTGAAAGAATTCAGGAAGGAGCTGACGAACTGCAGAAAATGCTTCAGGAAGATGAATTGCAAGATGCAGTGTTGCTGCTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCTACACAAGGAACTGGTCTTTATGAAGGACTTGACTGGCTGTCGAATGAACTTTCAAAACGTTAAATGAAACTGGATATTTAACCAAGGACACGTTTGATAGAATTGGTCTAGGCTTGTTACAACAAAATTAGTTTGCATCTTGGTTATTAAACAGTATCTGGGACTGGTTTGGGCAGAAGATTACAGCGTTTAAACTTATTTTGTTGCCAATTATTGTTTACCAAGTATAATGTTGCCATTTAGCAATATGCTTGGTTTTAAAGAAATTCTCCTTAACTTGGAAAAAAAAGTGTCCTCTTTTAATTTTACTTCCCTTAAGCCTAAATGCCTGGACATAGCTATTGTGACACCTTTAAATAAATCCGTTTTGAATGTTTTTTGAGCCCACAACAATAATGTTTTAAAGTTTTTCCCTTGCTACTTTACTGATACCTTTATCATTCCTGGGACAGTCTGCTGATTTAAAAATGTAGCATTCCATTTGTATTTATTTTTCTCCCTTGCCAAAAAGATTTTTTAATATCGCTTGTACCAGCCAGGAAATGTTCCAAAACACTATTCAGATCTGTTGCACTGAGGAACTTATTTTTTTGCCTGTCATTGACTCCTGGCTTCCATCAGCCAAGCTTACCTTGGTGCGGTTTGGATTTGATAGCTAAATAGTTCTTTGCTGATTGCAAAGAGTTCATATTGAGAAGAGTTTTTAATACCCAGCAGATTGTCTTTCTTTATATTGTATCTTTTTTATGTTGCATGTTGCTTTTGGTATCAGCCTGACTCTTTACCCAGTGTATGATAGTTCTGCTGATGTTTTATTGTTTATTGGTGAACATATCTTCATTAAGAGTTTTTGGAAAACTCATCAGACTCAAATGAATAAGTTTTCTTCATAACCCATTTGAAATTATTCCTAATAAAATGATAAAATATGT