Transcript asmbl_13398

Sequence
Transcript Sequence for observation asmbl_13398 of TGE0000150:
GAGGGAGGCCGGCGGCCACTCGGCGGGGGAGGGGACCGTGGCTGGAGCCCGGGGCGGGGCCGCGCGGCAGGCGGGGCGGGAGCCGGGGGGCGCAGCTAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGCCCGGCAGCCATGGCGGTGGAAGGAGGAATGAAATGTGTGAAGTTCTTGCTCTACGTCCTCCTGCTGGCCTTTTGCGCCTGTGCAGTGGGACTGATTGCCGTGGGTGTCGGGGCACAGCTTGTCCTGAGTCAGACCATAATCCAGGGGGCTACCCCTGGCTCTCTGTTGCCAGTGGTCATCATCGCAGTGGGTGTCTTCCTCTTCCTGGTGGCTTTTGTGGGCTGCTGCGGGGCCTGCAAGGAGAACTATTGTCTTATGATCACGTTTGCCATCTTTCTGTCTCTTATCATGTTGGTGGAGGTGGCCGCAGCCATTGCTGGCTATGTGTTTAGAGATAAGGTGATGTCAGAGTTTAATAACAACTTCCGGCAGCAGATGGAGAATTACCCGAAAAACAACCACACTGCTTCGATCCTGGACAGGATGCAGGCAGATTTTAAGTGCTGTGGGGCTGCTAACTACACAGATTGGGAGAAAATCCCTTCCATGTCGAAGAACCGAGTCCCCGACTCCTGCTGCATTAATGTTACTGTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCCATAAGGAGGGCTGTGTGGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTGCTGGTGGTAGCTGCAGCAGCCCTTGGAATTGCTTTTGTCGAGGTTTTGGGAATTGTCTTTGCCTGCTGCCTCGTGAAGAGTATCAGAAGTGGCTACGAGGTGATGTAGGGGTCTGGTCTCCTCAGCCTCCTCATCTGGGGGAGTGGAATAGTATCCTCCAGGTTTTTCAATTAAACGGATTATTTTTTCAGACCGAAAAGAGATGGTCTGAGTTTGTCTTAGAGTGATGCTTG