Transcript asmbl_46665

Sequence
Transcript Sequence for observation asmbl_46665 of TGE0001625:
TTCCTGCCGCGCGCGGCCATTTTTGCTCTTTCTTTGCTACTTTCCGGTCGAAGAGAGTGTTCCTGCTCTGACGTCGGCGGCCCTCCGTGAGGGAGGCAAGACGGCGGAACCGCAGCCATGACTGAGGCTGATGTAAATCCGAAGGCCTACCCTCTCGCAGATGCCCACCTCACCAAGAAACTATTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAAGCCACCAAAACCCTCAACAGAGGCATCTCTGAGTTCATTGTGATGGCTGCAGACGCCGAGCCCCTGGAGATCATTCTGCATCTCCCACTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTCGTGCGCTCCAAGCAGGCCCTGGGGCGGGCTTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCACAGCTGAAGCAGCAGATCCAGTCCATTCAGCAGTCCATCGAAAGGCTCTTAGTCTAAACCGGTGGCCTCTGCCACACTCTCCTACTGACTCCTCCCTCCGGGTTGTGTATCATATTTTCTGTTAGCATGTAGTATTTCCAGCTACTTTCTATTGTTATAAAATATTGTAATACTAAGTCTGGTTTTTACACTTTTGTATTATTTTTGTTTTGTCTTACAGGTCGTCATCTGCCCCCTACCCCTACCCTAATCTTTCTTTCCATTTTCTGCTGTCTTTCCTCCCTTTCAAAAAATGAACTAATGCCCAGAACAGGCAGAAACAGAGTGGTGACACCATTCAAAGGCAGAGAAGAGCCAGGATTGAGATCCACTTCCAGCTTTCAGGCACTAACTCCCTACTGTGTGCAGGACATGATAAAGTAACCACCACCCACTTGGTATCCCTTGTGGCTGGCATACATAATTATTCCATACTTGTTTAAATGATCTGGGGGTTTCCTTTGCTTTCCAGGGGATTATATATCATTTGGGGAGGAAGCATGTATTCTGCGAGGTGGTTCGTTGTGTCATTTGCTAACATGCCACTGCTGTTTCCTTTTGGGAATATGTTATGTTCCCCCCTAACTCCCAGCTGTGCCCCTGAGGGTGACAGGACAGCACCGTACCAGAGAGATATGTGCGCAGAATTCCAGAGGTGGCCTAGGCGAGTGAGTTATGGGGCTTCAAGGAGTCTGGAGGGGCAAGAGAAGAGGCTCAGCTGGTTCTGGAATGCAGGATTCGGGGCAAGTCATGGAGACCTAGAAGCTACAGCAGAGATGATGGGTCCAAGGAGACAGCCTCTGGTGACTGCAGATTTCTTCAGTGGACACTTGGTACCAGCTCTGAGAGCCCTTAACCCTATTTCCTGGGTCAGGTGTATGTTCTTTATCACATCAGAAGGACAGTGCTAATGTGTCATTCTTGTGAGCATCCTAGTAAAGAAATATATTCATAGTCCAATTTAAAGAAAGTGTCATTCTTGGTAGGTATCCAGCTAATACCTGTTTGAAGAACTACTTAGCATTATTAGAGTGGTTTTAGCTTCTCAAACTTTCCACCAAGAAGCTGTGGAAAGCCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATGATGGTTTTAGCTTCTCAAACTTTCCACCGAGAAGCTGTGGAAAGCCATCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATATCTAATAAA