Transcript asmbl_46460

Sequence
Transcript Sequence for observation asmbl_46460 of TGE0013034:
AAAAAACTTTACTATGACACGGACTATGGTTCCAAGTCCCGAAGCCGGCAGAGTCAACAAGAAGTAGAGGATGAGGAAAAAGAGGAGGAGGAGGAGGCACAGCTCATTCAGCGGCGCCTAGCCCAAGCACTGCAAGAGGATGATTTTGGGGTCACCTGGGTGGAGGCCTTTGCAAAATCGGTGCCTCGGGTAGATGAGGCTGAGACACGAGTCGTGAAGGATTTGGCGAAAGTTTCCGTGAAAGAGAAACTAAAGATGCTGAAGAAGGAATCACCAGAGCTCTTGGAGCTGATAGAAGACCTGAAAGTTAAGTTGACAGAGGTGAGGGATGAGCTGGAGCCATTGTTACAGTTGGTGGAGCAAGGGATCATTCCACCTGGAAAAGGAAGCCAATACCTGAGGACCAAGTACAACCTCTATTTGAACTACTGCTCCAACATCAGTTTTTATTTGATCCTGAAAGCTAGGAGAGTCCCTGCACACGGACATCCTGTCATAGAAAGGCTCCTTACCTACCGAACTTTGATTAACAAACTCTCAGTTGTGGATCAGAAGCTGTCCTCTGAAATTCGTCACCTACTCACACTTAAGGATGATGCTGGAAAGAAAGAACTGAATCTAAAAGCAAAATCCACCAAGGTCAAACCAAAATCTGTTTCCGAGACTGTTGCTGCCGCCTCTGCTGTTACAGATCTTTCTGATGATTCTGATTTTGAAGAAGCTGCACTGAAATACTATAAAGAAATAGAAGATGGGCAAAAGTTGAAAAGAAAGAAAGAAGAAAATAGTACTGAAGAACAAGCTCTTGAAGATCAAAATGCAAAGAGAGGCATTACCTATCAGATTGCTAAAAACAGAGGACTTACACCAAGGAGAAAGAAGATCGATCGCAATCCCAGAGTGAAACACCGGGAGAAGTTCAGAAGAGCCAAAATTCGTAGAAGAGGCCAGGTTCGTGAAGTTCGTAGAGAAGAGCAACGTTATAGTGGTGAACTATCTGGTATTCGTGCAGGGGTTAAAAAGAGCATTAAGCTTAAGTAAAGTTTTTGCTTTAAGTTTTTTGGCCATTTTAGATCAATAAATTTGAATTTTTAACTGGTGAAGTTATTGTAGTAATGTATAATACCTAATCCTTAAGTTTTAAAAATTTCAGTCAACAGGGAAATTCGTTTGCATTATTGCTCAGTTTATCCTTCAGTTTCTATTAGGGTCATACTAAGAACTGTGGGAACAATATGCAGGTGCGTGAAAAAAAGTTCTCTGATATTCTGTCAGGTAGTAGCCTAGGAAAATTTCACATCTAGTTATGGAACAACAGTCAAACTTAGAACAGCCTTATAATTCTTCATGTAAATTGAAGAGAATCCACATTTGGCAATCATCTTGTTAGTAAGATAGCCTATAAAATAGTTCTGACATTATTTCATTTACCTAAGTATAGTTCTTGAGCAGGATACTTGTTAATAAATAGGTTTAATGTTAGCTTACGGATTTTGTACATTATATGTAGCAAAAGCTTAGAAATGAAGAGGAACTTTGGTTAAAAGTGGAAAAATGTGCCTTAATTACATTAATTTTGAATATTTTTTAATGGTCCTTAATGTGGTAAGGTAAAAATACCATTTTCTCTTCTGTACTGGTGACTTGCAGCTGTT