Transcript asmbl_46349

Sequence
Transcript Sequence for observation asmbl_46349 of TGE0013027:
AGAGAATCCCACCCATGTAAGCCACCTGTCCCCCACTTGCCAGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAATGTGCAGGCACACAGCAGCCTCATCCGGAACTTTGAACAGCTGGGGGCCACCGTCACCAACCCCGGGGGCCCTGGGACCTCCAGCCGGCTGGAGCGGAGAGAGCGTTTGGAGCCCACCTATCAGCTGTCCCGCTGGACCCCAGTTATCAAGGATGTGATGGAGGATGCTGTGGAGGACCGGCTGGACCGCAAACTGTGGCCCTTTGTGTCTGACCCTGCCCCCACACCCAGCTCCCAGGCTGCTGTCAGTGCCCGCTTTGGCCACTGGCACAAGAACAAGGCTGGTGTGGAGGCGCGGGCAGGGCCCCGGCTTATCGTCTATGTCGTGGGTGGCATGGCCATGTCAGAGATGAGGGCTGCCTATGAAGTGACCAGGGCCACTGATGGCAAGTGGGAGGTGCTCATTGGCTCCTCACACGTCCTCACCCCAACCCGCTTCCTGGACGACCTGAAGATGCTGGACCAGAAGTTAGAGGACATTTCCCTGCCTTGACCCGCCCACCCCTACCCTGACCTGCCCTCTT