Transcript asmbl_13396

Sequence
Transcript Sequence for observation asmbl_13396 of TGE0000149:
TGCTGCTGCTGCCGCCGCCACCCAGGGTCGGGGGCTTCAACTTAGACGCGGAGGCCCCAGCAGTACTCTCGGGGCCCCCGGGCTCCTTCTTCGGATTCTCAGTGGAGTTTTACCGGCCGGGAACAGACGGGGTCAGTGTGCTGGTGGGAGCACCCAAGGCTAATACCAGCCAGCCAGGAGTGCTGCAGGGTGGTGCTGTCTACCTCTGTCCTTGGGGTGCCAGCCCCACACAGTGCACCCCCATTGAATTTGACAGCAAAGGCTCTCGGCTCCTGGAGTCCTCACTGTCCAGCTCAGAGGGAGAGGAGCCTGTGGAGTACAAGTCCTTGCAGTGGTTCGGGGCAACAGTTCGAGCCCATGGCTCCTCCATCTTGGCATGCGCTCCACTGTACAGCTGGCGCACAGAGAAGGAGCCACTGAGCGACCCCGTGGGCACCTGCTACCTCTCCACAGATAACTTCACCCGAATTCTGGAGTATGCACCCTGCCGCTCAGATTTCAGCTGGGCAGCAGGACAGGGTTACTGCCAAGGAGGCTTCAGTGCCGAGTTCACCAAGACTGGCCGTGTGGTTTTAGGTGGACCAGGAAGCTATTTCTGGCAAGGCCAGATCCTGTCTGCCACTCAGGAGCAGATTGCAGAATCTTATTACCCCGAGTACCTGATCAACCTGGTTCAGGGGCAGCTGCAGACTCGCCAGGCCAGTTCCATCTATGATGACAGCTACCTAGGATACTCTGTGGCTGTTGGTGAATTCAGTGGTGATGACACAGAAGACTTTGTTGCTGGTGTGCCCAAAGGGAACCTCACTTACGGCTATGTCACCATCCTTAATGGCTCAGACATTCGATCCCTCTACAACTTCTCAGGGGAACAGATGGCCTCCTACTTTGGCTATGCAGTGGCCGCCACAGACGTCAATGGGGACGGGCTGGATGACTTGCTGGTGGGGGCACCCCTGCTCATGGATCGGACCCCTGACGGGCGGCCTCAGGAGGTGGGCAGGGTCTACGTCTACCTGCAGCACCCAGCCGGCATAGAGCCCACGCCCACCCTTACCCTCACTGGCCATGATGAGTTTGGCCGATTTGGCAGCTCCTTGACCCCCCTGGGGGACCTGGACCAGGATGGCTACAATGATGTGGCCATCGGGGCTCCCTTTGGTGGGGAGACCCAGCAGGGAGTAGTGTTTGTATTTCCTGGGGGCCCAGGAGGGCTGGGCTCTAAGCCTTCCCAGGTTCTGCAGCCCCTGTGGGCAGCCAGCCACACCCCAGACTTCTTTGGCTCTGCCCTTCGAGGAGGCCGAGACCTGGATGGCAATGGATATCCTGATCTGATTGTGGGGTCCTTTGGTGTGGACAAGGCTGTGGTATACAGGGGCCGCCCCATCGTGTCCGCTAGTGCCTCCCTCACCATCTTCCCCGCCATGTTCAACCCAGAGGAGCGGAGCTGCAGCTTAGAGGGGAACCCTGTGGCCTGCATCAACCTTAGCTTCTGCCTCAATGCTTCTGGAAAACACGTTGCTGACTCCATTGGTTTCACAGTGGAACTTCAGCTGGACTGGCAGAAGCAGAAGGGAGGGGTACGGCGGGCACTGTTCCTGGCCTCCAGGCAGGCAACCCTGACCCAGACCCTGCTCATCCAGAATGGGGCTCGAGAGGATTGCAGAGAGATGAAGATCTACCTCAGGAACGAGTCAGAATTTCGAGACAAACTCTCGCCGATTCACATCGCTCTCAACTTCTCCTTGGACCCCCAAGCCCCAGTGGACAGCCACGGCCTCAGGCCAGCCCTACATTATCAGAGCAAGAGCCGGATAGAGGACAAGGCTCAGATCTTGCTGGACTGTGGAGAAGACAACATCTGTGTGCCTGACCTGCAGCTGGAAGTGTTTGGGGAGCAGAACCATGTGTACCTGGGTGACAAGAATGCCCTGAACCTCACTTTCCATGCCCAGAATGTGGGTGAGGGTGGCGCCTATGAGGCTGAGCTTCGGGTCACCGCCCCTCCAGAGGCTGAGTACTCAGGACTCGTCAGACACCCAGGGAACTTCTCCAGCCTGAGCTGTGACTACTTTGCCGTGAACCAGAGCCGCCTGCTGGTGTGTGACCTGGGCAACCCCATGAAGGCAGGAGCCAGTCTGTGGGGTGGCCTTCGGTTTACAGTCCCTCATCTCCGGGACACTAAGAAAACCATCCAGTTTGACTTCCAGATCCTCAGCAAGAATCTCAACAACTCGCAAAGCGACGTGGTTTCCTTTCGGCTCTCCGTGGAGGCTCAGGCCCAGGTCACCCTGAACGGTGTCTCCAAGCCTGAGGCAGTGCTATTCCCAGTAAGCGACTGGCATCCCCGAGACCAGCCTCAGAAGGAGGAGGACCTGGGACCTGCTGTCCACCATGTCTATGAGCTCATCAACCAAGGCCCCAGCTCCATTAGCCAGGGTGTGCTGGAACTCAGCTGTCCCCAGGCTCTGGAAGGTCAGCAGCTCCTATATGTGACCAGAGTTACGGGACTCAACTGCACCACCAATCACCCCATTAACCCAAAGGGCCTGGAGTTGGATCCCGAGGGTTCCCTGCACCACCAGCAAAAACGGGAAGCTCCAAGCCGCAGCTCTGCTTCCTCGGGACCTCAGATCCTGAAATGCCCGGAGGCTGAGTGTTTCAGGCTGCGCTGTGAGCTCGGGCCCCTGCACCAACAAGAGAGCCAAAGTCTGCAGTTGCATTTCCGAGTCTGGGCCAAGACTTTCTTGCAGCGGGAGCACCAGCCATTTAGCCTGCAGTGTGAGGCTGTGTACAAAGCCCTGAAGATGCCCTACCGAATCCTGCCTCGGCAGCTGCCCCAAAAAGAGCGTCAGGTGGCCACAGCTGTGCAATGGACCAAGGCAGAAGGCAGCTATGGCGTCCCACTGTGGATCATCATCCTAGCCATCCTGTTTGGCCTCCTGCTCCTAGGTCTACTCATCTACATCCTCTACAAGCTTGGATTCTTCAAACGCTCCCTCCCATATGGCACCGCCATGGAAAAAGCTCAGCTCAAGCCTCCAGCCACCTCTGATGCCTGAGTCCTCCCAATTTCAGACTCCCATTCCTGAAGAACCAGTCCCCCCACCCTCATTCTACTGAAAAGGAGGGGTCTGGGTACTTCTTGAAGGTGCTGACGGCCAGGGAGAAGCTCCTCTCCCCAGCCCAGAGACATACTTGAAGGGCCAGAGCCAGGGGGGTGAGGAGCTGGGGATCCCTCCCCCCCATGCACTGTGAAGGACCCTTGTTTACACATACCCTCTTCATGGATGGGGGAACTCAGATCCAGGGACAGAGGCCCCAGCCTCCCTGAAGCCTTTGCATTTTGGAGAGTTTCCTGAAACAACTTGGAAAGATAACTAGGAAATCCATTCACAGTTCTTTGGGCCAGACATGCCACAAGGACTTCCTGTCCAGCTCCAACCTGCAAAGATCTGTCCTCAGCCTTGCCAGAGATCCAAAAGAAGCCCCCAGCTAAGAACCTGGAACTTGGGGAGTTAAGACCTGGCAGCTCTGGACAGCCCCACCCTGGTGGGCCAACAAAGAACACTAACTATGCATGGTGCCCCAGGACCAGCTCAGGACAGATGCCACACAAGGATAGATGCTGGCCCAGGGCCCAGAGCCCAGCTCCAAGGGGAATCAGAACTCAAATGGGGCCAGATCCAGCCTGGGGTCTGGAGTTGATCTGGAACCCAGACTCAGACATTGGCACCTAATCCAGGCAGATCCAGGACTATATTTGGGCCTGCTCCAGACCTGATCCTGGAGGCCCAGTTCACCCTGATTTAGGAGAAGCCAGGAATTTCCCAGGACCCTGAAGGGGCCATGATGGCAACAGATCTGGAACCTCAGCCTGGCCAGACACAGGCCCTCCCTGTTCCCCAGAGAAAGGGGAGCCCACTGTCCTGGGCCTGCAGAATTTGGGTTCTGCCTGCCAGCTGCACTGATGCTGCCCCTCATCTCTCTGCCCAACCCTTCCCTCACCTTGGCACCAGACACCCAGGACTTATTTAAACTCTGTTGCAAGTGCAATAAATCTGACCCAGTGCCCCCACTGACCAGAACTAGAA