Transcript asmbl_46057

Sequence
Transcript Sequence for observation asmbl_46057 of TGE0005670:
CCAGAACCTGCGTGGGGTGGTGGTCAGAGGGGTTAAATGTTTGTGCTTTCTGTGCACTTTTAATCGCCAGCTGAACTGCTCTTGATTTTGTAGGGTCGATAAAGATCGGAGCGGTGTGATATCCGACAGTGAGCTCCAGCAAGCGCTCTCCAATGGCACCTGGACTCCATTCAACCCCGTGACGGTCAGGTCGATCATATCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTCCCATCCGCCTCAGAAGCGCGTGCGGGGTCCGGGGCATGGCTCTGCCTGTGGAGAAGTGTGGGTACCTCCCTTCGCGTTCCAGGAGTTTAAATTTCATAAAACTTTGGACACACA