Transcript asmbl_46055

Sequence
Transcript Sequence for observation asmbl_46055 of TGE0013005:
GGGCACCTCTGGTATGACAGGCCCGGAGACCCCGCCCACTTTCTAGCCATGGAGGAGACCGGCCGGGAGGCTGTGGCGACCGCGGTGCAGAGGGTGGCCGGGATGCTCCAGCGGCCGGACCAGCTGGACAAAGTGGAGCAGTATCGCAGGCGAGAGGCCCGGAAGAAGGCCTCCGTGGAGGCCAGACTGAAGGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACA