Transcript asmbl_45631

Sequence
Transcript Sequence for observation asmbl_45631 of TGE0005644:
GGAACTTCCATAAAGTCATTTCCGGGAAGCGGGGTCGCGCTTTGTTCGCTGCAACATGGAGGCGAGTGGCGGAGCCGATGAGGCGGTTTCCGGGGAATTGGTGTCGGTGGCTCACGCTCTTTCTCTCCCCGCCGAGTCTTATGGCAACGATCCTGATATCGAGATGGCTTGGGCCATGAGAGCAATGCAGCACGCCGAAGTCTACTACAAGCTGATTTCATCAGTTGACCCACAGTTCCTGAAACTTACCAAAGTGGATGACCAAATCTATTCTGAATTTCGGAAAAATTTTGAGAATCTCAAGATAGATGTATTGGACCCAGAAGAGCTCAAATCGGTATCAGCTAAAGAGAAGTGGAGGCCATTCTGTTTGCAGTTTGATGGGGTTATAGAAGACTTCAACTATGGTACTTTGCTGCGACTGGATTGTTCTCAGGGCTACACTGAGGAAAACACAATCTTTGCCCCCAGGATACAATTTTTTGCCATTGAAATTGCTCGGAACAGGGAAGGCTATAACAAAGCAGTTTACGACAGTGTTCAGGACAAAGAAGACAAAGGGGCCAACAATGGCGAAAAAGAGAAAAGCGACAAAGGAGAAGAGAAAGAGAAAAAAGCCAAGAATGGAGTCAATGAAAGCGACGAAATAGCTATGTAAGGTAGACAGGGGACAGCACTCTAGAAACTGTGACTCGGCGGAGTCTACAAGTACCATGATGTTACTTGCACAGAACCCTACGGTTAAAGGTACGCCCTGTGCAGTCGAAGGCCATCTTTCTAGCCTAATAATCAGGAGCTGTTCTGATTGTTCTCTTGTAGGAATTGGCTTAAAGGCTATTAGTGGAGTCATAGTGGATTGTTTCTTGTTATATTTTTTCTTGTTATTTTTTTTCCACCAGTTACGTAAGAAATTTTGTAAATAAATTTCTTTTGGTTCTTA