Transcript asmbl_45424

Sequence
Transcript Sequence for observation asmbl_45424 of TGE0005638:
CCCGAACCGGAAAAGGTGGGTTTCCGGACGCTGCACCTGCCTGGGTGTAGGTGTAGGTGAGCCGCAGTCTCCGCGAGACCTTCCAGAATTATAAAGCTGTCCTCAGAGATCCGAAAAATGGCAACAAATGAAAATGTCAGCATCTTTAGTTCAGCGTCCTTGGCTGTGGAGTATGTAGATTCACTGTTACCTGAGAATCCTCTGCAAGAGCCATTTAAAAATGCTTGGAACTATATGTTAGATAATTATACAAAGTTCCAGATTGCAACATGGGGATCCCTGATAATTCACGAGGTCATTTATTTCTTGTTCAGTTTACCTGGATTTTTGTTTCAATTTATACCTTACATGAAAAAGTACAAAATTCAGAAGGATAAACCAGAAACATGGGAAGGCCAATGGAAATGCTTTAAAGTACTTCTCTTTAATCACTTTTGTATCCAGTTTCCTTTGATTTGTGGAACTTATTATTTTACAGAGTATTTCAATATTCCTTATGATTGGGAAACAATGCCAAGATGGTATTTGCTTCTGGCAAGATGCTTTGGTTGTGCAGTGATTGAAGATACCTGGCACTATTTCTTACATAGGCTCTTGCACCACAAAAGAATATATAAATATATTCATAAAATTCATCATGAGTTTCAGGCTCCATTTGGAATGGAAGCTGAATATGCACATCCCCTTGAAACGCTAATTCTTGGAACTGGATTTTTCATTGGAATTGTTCTTTTATGTGATCATGTAGTTCTTCTTTGGGCATGGGTGACCATTCGTTTGCTAGAAACTATCGATGTCCACAGTGGTTATGATATTCCTCTCAACCCTCTAAATCTCATCCCATTCTATGCTGGTTCTCGACATCACGATTTTCACCACATGAACTTCATTGGAAACTATGCTTCAACATTCACGTGGTGGGATAGAATTTTTGGAACAGACTCTCAATTTATTGCCTACACTGAAAAGATGAAGAAGATTAAGAAAAAGGCTGAATAAATATCTATGTAAACCTTCCTGAAGAAACACATTTTCCTGGATTAAAAGTAGTAGCTAACATTGCTTCTGGGGAGCAGAAACAAACATGTCTTGGCTGCTAAGTGATGGAAAAAAATTAACAACCTTTATCTTCCTAGTGGGAACTTTTTCTATTTTCCATTCAAGTTCTGTATGTGTAGAAATAAGAAAGGAAGTTTTAAAGGCCGTGTTGCTAACTTTACAAAAAGATTTGTGTAAAGTAAATGGAAAAAGGATTAACCTGTCTGTCCCTACCATTAATACTATAGACCTGAAGTTGAAGTTGGTCTTTAAATCTTAGTGGCCATTTTAACAACTTTTATTAGTGAATGTTGACCTCATCTTGAACTTTAAACGTTTTTTAGAATTTGCCTAAAGATCAAAATATGGGATGAATGACATCAGTTGATACGATGTGAGTGGGGCTGCAAAATCAGGAATAGCCAACACCAAGAATTTCTACTCTTGTCTGGAGCTGACCGATTTGGGGTGATTTTCTTTGAGAAGTCCTTTTGGGTCCCTACTATTGACATCTATAAATTAAAGCAAATCTGAATCGATGTAAGTGGAATATTTTAGTCTAAAGGTTTTCAGGTTTCTTGAATTTTAAATAAATAAATAAATAAACCTTTATTTCTGCCACTTACTGTTTAATATTTGAAAATCAGGTTTTTATTATACTTAAAACTGTATCTTAAAATTTTGTGAACCTACTTGGTGTATTTGCACTTTGAGCTACTGAAATAAATGTGATTTTTTTGCGTCTGGTTATCTGGTCTCCAATTTTGAACATCAGCTGTCACTTTTTATAAGGAAAAGTACATAAATCATTAAATTATTGTTTTATAATAAAAGGGATAATTTTATTTTTA