Transcript asmbl_44571

Sequence
Transcript Sequence for observation asmbl_44571 of TGE0005590:
GCCGCGGGCGCGCCTCCTCCCTGAGCTAACTGTGTGCGCCCCAGCCGCGCGCAGCTACTCGCGTCCGAGCCTCGCGCAAGCTCTCGTGTGTGCCGTGTCGTTTGGCGTCCACCTACCCCTCCGCTCTCCTTGCAAGTACCCCGCGCGTCTGCCACGCAGTCATGTCGTCCGGCAGCCGCGTTGCGCTGGTGACCGGCGCCAACAAGGGCATCGGCCTTGCCATTGTGCGCGACCTGTGCCGGCAGTTCTCCGGGGACGTGGTGCTCACAGCGCGGGACGCGGCGCGGGGCCAGGCAGCCGTGCAGCAGCTGCAGGCCGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGACCTGCAGAGCATCCGCGCCCTGCGCGACTTTCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCCGGCATCGCCTTCAAGTTAAAGGATCCCACACCGTTTCATATACAAGCAGAAGTGACAATGAAAACAAACTTTTTTGGTACCCGAGATGTCTCCACGGAACTACTGCCTCTCATGAAACCCCAAGGCAGAGTGGTGAATGTGTCCAGCAGCGTAAGCCTCACTGCTCTCAGGAGCTGCAGCCCAGAGCTGCAGCAGCAGTTTAGAAGCGAGACCATCAGTGAGGAGGAGCTGGTGGGGCTCATGAACAAGTTCGTGGAAGATGCGAAGAACGGTGTGCACCAGGAGGCGGGCTGGCCTACTAACGCCTACGGAGTGACGAAAATCGGTGTCACGGTCCTGTCCAGAATCCAGGCCAGGAACCTGAGCACGCAGAGGAAAGGGGACAAGATCCTCCTGAATGCCTGCTGTCCAGGGTGGGTGAGAACTGACATGGCGGGATCCAGAGCCCCCAAAAGCCCGGAGGAAGGCGCAGAAACCCCCGTGTACTTGGCCCTTTTGCCCTCGGATGCTACAGAGCCTCATGGGCAGTTTGTTAAGGAGAAAAAAGTTGAACAGTGGTGAGTGAGCTCAACCCATAGAGCTCCATCCATAGTTTCCATGTTGTACCCGTCCTGATTTGATCCAAAGTGTGTTTAACACAGTCAAAACTATCCCTACCAAGGATTCACTTTGAATTGTCTACCAATTCTATGAAGCCTTTTGTAATTTGTGATGTTTATGCAGTTCTCTGTGATATTCTATAGGGAGAACACATGTGTTAGTGCTGATAATAACGAATTAAAATCAATAGAGGAA