Transcript asmbl_44476

Sequence
Transcript Sequence for observation asmbl_44476 of TGE0012939:
GGGGGATCCGCCGCGGAGTTACGGGAAAGTTGTTCCGAGTTCCTGGAGTTTCCTCTGTGGTTCCCGGGCTCCGCCGGCCGGTGGCCCGGCCTCTTTCCTCCCTCTGGCCTTCCCTGCTCACCAGGTCCTTCCTTTAGCCCCCGGCCGCCATGGAGCAGCCGCCGGCCCCCAAGAGTAAGTTAAAAAAGCTGAGTGAAGACAGTTTGACTAAGCAGCCTGAAGAAGTTTTTGATGTGTTAGAGAAACTTGGAGAAGGGTCTTATGGAAGTGTGTTTAAAGCAATACATAAGGAATCTGGCCAAGTTGTGGCAATTAAACAAGTACCTGTTGAATCAGATCTTCAGGAAATAATCAAAGAAATTTCCATAATGCAGCAATGTGACAGCCCATATGTTGTAAAGTACTATGGCAGTTACTTTAAGAACACAGACCTCTGGATTGTTATGGAATACTGTGGAGCAGGCTCTGTCTCGGACATAATTAGATTACGAAACAAGACATTAACAGAAGACGAAATTGCAACTATTCTTAAATCTACTTTGAAAGGACTAGAATATTTACACTTTATGAGAAAAATACACAGAGATATAAAAGCTGGAAATATTCTCCTCAATACAGAAGGACATGCAAAATTGGCAGATTTTGGTGTGGCTGGTCAGTTAACGGATACAATGGCAAAACGCAATACTGTGATAGGAACCCCATTTTGGATGGCTCCTGAGGTAATTCAAGAAATAGGATATAACTGTGTGGCTGACATCTGGTCCCTTGGCATTAC