Transcript asmbl_44429

Sequence
Transcript Sequence for observation asmbl_44429 of TGE0005575:
CCCTTTCTTCCTGTCTGGCTGAAAGATGGCGTCTCGCAAGGAAGGCACCGGCTCTGCCACCACCTCTTCCAGCTCCACCACAGGTGCGGCAGGAAAAGGCAAAGGCAAAGGCGGGTCTGGAGATTCGGCCGTCAAGCAAGTGCAGATAGATGGCTTGGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACTGAGGTGGTTCAAGGAGTACTTTTGGGCCTGGTTGTAGAAGATCGGCTTGAAATCACCAACTGCTTTCCTTTCCCGCAGCACACAGAGGACGATGCCGACTTTGACGAAGTCCAGTATCAGATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGACCACCTCCACGTGGGCTGGTACCAGTCCACCTACTACGGCTCGTTCGTCACCCGGGCACTCCTGGATTCCCAGTTCAGTTACCAGCATGCCATTGAAGAATCTGTCGTTCTCATTTACGATCCCATAAAAACTGCCCAAGGGTCTCTCTCACTGAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAGAAGGATTTTTCCCCTGAAGCATTGAAAAAGGGAAGTATCACCTTTGAGCACATGTTTGAAGAAGTGCCGATCGTAATTAAAAATTCACATCTGATCAACGTCCTAATGTGGGAGCTTGAGAAGAAGTCAGCTGTGGCAGATAAACATGAATTGCTCAGTCTTGCTAGCAGCAATCATTTGGGAAAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATATAACACATACATGAGGAACACGAGTAAACAGCAGCAGCAGAAACACCAGTATCAGCAGCGTCGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGGGAGCCCCCGCTTCCTGAGGAGGATCTGTCCAAACTCTTCAAGCCTCTGCAGCCTCCAGCCAGGATGGAGTCTCTGCTCATTGCAGGCCAGATTAATACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAACTCTTCATGGCCCAGGCGCTTCAAGAATACAACAACTAAGAAAAAGAAGTTTCCAGAAAAGGAGTTAACATGGACTCTTGAGATCACATTGGGGCAACTCTTGGAAGAAATATGTTTGCATACTGAAAAGTCTTTTTAGCCAATAATAAAGTAT