Transcript asmbl_43285

Sequence
Transcript Sequence for observation asmbl_43285 of TGE0005521:
CGGGGGTGCTAGAATCTGGGGCTCAACGTTGGTCTCTTGGGAATGTGGAGAGCTGGCAGCATGTCGGCGGAGCTGGGAGTCGCGTTCGCTCTGCTGGCAGTGAACGAGCGCGTGCAGCAGGCGGTGGCACGGCGGCCGCGGGATCTCCCGGCCATCCAGCCCCGGCTAGTAGCCGTCAGCAAAACCAAACCTGCAGACATGGTGATTGAGGCCTATAGTCATGGCCAGCGCTCTTTTGGGGAGAACTATGTTCAAGAACTGCTAGAAAAAGCATCAAATCCTAAAATTCTGTCTTCATGTCCTGAGATCAAATGGCACTTCATTGGCCACCTGCAGAAACAAAATGTCAACAAATTGATGGCTGTCCCCAATCTCTTCATGCTGGAAACAGTGGATTCTATGAAGTTGGCAGACAAAGTCAACAGTTCATGGCAGAAAAAAGGTTCCTCTGAAAGGTTAAAGGTTATGGTCCAAATTAACACCAGTGGAGAAGAGAGTAAACATGGCCTTCTACCTTCAGAGACAGTAGCCATGGTGGAACACATAAATACCAAGTGCCCCAGCCTGGAATTTGTGGGGCTGATGACCATAGGAAGCTTTGGGCATGATCTTAGTCAAGGACCAAATCCAGACTTCCAGATGTTATTGTCTCTCCGGGAAGAGCTATGTAAAAAACTGAACATCACTGCTGACCAGGTTGAGCTGAGCATGGGCATGTCCATGGACTTCCAGCATGCAATTGAAGTAGGATCTACGAATGTCCGCATTGGAAGCACCATTTTTGGAGAGCGAGATTACTCAAAGAAGCCTGCCCTGGACAAGTCCGCAGCAGACCTGAAGGCCCCCATAGAAGTAACACAGGCACACTGAGCCAAGGAACAGCCAGCAGTGGCTCACAGCCTGTGGCCCTGTCCAGGAAGACTAACTATGCACCCATCTGGATTTTCATTTTGATATTCCCTAAGTTACAGCACAACCATGCTCTCTTTGTGACCTGGAGAGAGTGTGCTGAGGATTTTGTGTGCTGATGGAAATCTTCTGTATTTAGTGTCTGACATAGGGAGCTCGCTTCAAGTAATGGCCTTTGGATTGGATTTGAGAAATCCAGACATTTCTGCAGATATAAAATCAATAGGCAGGAATTGAGTTCAATATTAAATCCTGCCTGGGAGCACCAACTGACACATCAATGCCTTTCCCAGGTTAATATTTGGTCACTGGTGCCTATAATCTCCAAAGTCAGAGGGATTCCCATTTGTCGTTCACTTTAATAGAAAATTCCCTGTGGTTACAGACTCCATACAAACCCCTACTGAGTAATCATCTCTGCTGCCCTGGAGGAAGGTGATTT