Transcript asmbl_43265

Sequence
Transcript Sequence for observation asmbl_43265 of TGE0005515:
CGGTGACAGCATGGGTGAAGGGGAGTGTGGCAGGGGAGGCCTTGGGCTGCCTTGGGCGGTGGATGGGACTGCGGGGCTGGAGGCCTGGAATCCTGGGTCCAGGCCAGAGATCTGACCCGTGGTTGGTGTCCCCCGAACCCTCAGCGTGGCCCGTCTTGTCCTCGCCATGAGGCCGCAGCAGGCGCCGGTGTCCGGGAAAGTATTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCCGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTTGGGGGTCAATCATATCTTGAAGGCTGTTTGGCTTGTTTAACAGCATATACCATCTTCTTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATATATGCTCCCCAAGGCCTCCTCCTGACAGATCCCATTGAGAGAGGACTTCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAAACATAGAATTAAAGATCCCAACTCTAGCTGGGACCCTCATCTGTCCACTGGCCAATCGCAGAGTGTCCCCTACCTCCTCTCCAGAGCGTCATTCCTTTGTATCTGCTGCCAGAGCCACGGTGCCATTTCCTCCAAGGACTAACTTTCTAATATTCCACACCTGGAGTGACCTCTCGTCGCTCAGCATCCACTTTATGTCTCCAAATTGTGTAGGACTCTGTAATCTTTTGATTAGTTTCTGAGAAAACACAATGAAGCATTTCACTTTTTTATTCAAAGCCATTAATAAAATATGTAGTTAGTCAGCCCAACTCAAAGTTTATTTCTTATCTGCCACCAGTCCCAAATGGTTCTCGTCATTCCTTGGCCCAGCTTCCCAGGTGGCTGTAGACTTCAAAGTGATGTTAGCCAGTGTTCAGTCTTATTCCCCAAATAAAATGCTTTACTCCAGGATTTCAGTGAAGGGTAGGCTGTGTCTGTGGTTTTGCTAATGCATGTCCCAGATTTCAAAGAACTACCAGTTTTGCCATGACTCAAATCTTAAAGATGTTTCTGCCATTCAGTTTCTCAAACTGAAGCTCATTGGAAAAATAATGTGTAATGTTATTTGTTTTATTATAGCAATTATTCCTAATTAAAGCAGTATTAAATGCAATTTCCAGTTATTTTTCTTTGGAGAATTTTGTTATTATTGTATTACCTTGAATGTTGAGAAGATGTGGTATGTGTTGCTTGTTCCTTACAAAAATAAGCACAATAAAGTGGATGCTAAACCATCAGACACATAAATGTCCCTGCTGTTTCCCTGAAAGTGTAATAAGCAAGTATAATAAATATTTTAATTATAGTTTTGTTATAAATATAACTTATGAGAAAAAATTTGATAGGAATAATACTGTATATTGCTAATTTTTAACTATCTCTGCTGGCAAACCTTATTCATAGACTCTCATATACAGTATTCAATGCACAGAAATCTTATGATTGGTTCAAGTACAGTAAGTTAAGTAATTTCCAACTAAAACTCAAGTCTGAGTCAACATTTCTAGTTCCTTTGGCCGTATGTTCTCAGCATCAGGGCTTCTATGCCCTTCATTCACACATGGGCTTTGAAAGAGAGCACCATATTTGGGAGAGAGTTAAGAAATATTTTAGGAGAGAATGAAACAGTTAAGTTTTACTTTCAGAGATATTGTAGGTGCTAATACTGGATTTAATCTTTCATATGTAATTCC