Transcript asmbl_43244

Sequence
Transcript Sequence for observation asmbl_43244 of TGE0005512:
CCATCCCTCAGGCTTCTCCCGCTTCACGTCAACCCCTGCCCTGGCCACCTGCGCTCCGGGCCCAGCTGCGCACGCGCGCATCCAGAGCCAGACAGTTGGTGGTGTTGGTACGCCCCAGCTGTTCCTCTCCGCACGCAACCCCGCGTCGCGCGACCCCGGTGTGACACCACGGCGCAAACGCGGCGCGGGGGGAGGCAGGGGCGCGCAGGCGCCGCGGGGGGAGTGAGGCCGCGCAGGCGCGGACGGCGTTGGTTGAAGAAGACCTTCAGCGTTGCCCTGGCGGAGCGGAGACCGGCTCTCTCTGGGTGGAGATATGTGTAACACACCGACTTACTGTGACCTAGGAAAGGCTGCCAAGGATGTCTTCAACAAAGGATATGGGTTTGGCATGGTAAAAATAGATCTGAGAACCAAGTCATGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCGTACACTGATACAGGGAAAGCGTCAGGCAACCTAGAGACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAAAAATGGAACACAGACAATACTCTTGGAACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATCTTTGTACCGAACACAGGGAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTCAGTCTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTAGCCCTTGAAGGTTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCTAAACTGTCACAGAATAATTTCGCCCTGGGTTATAAGGCTGCAGATTTCCAGCTGCACACTCACGTGAATGATGGCACTGAATTTGGAGGGTCTATCTACCAGAAGGTTAATGAGAAGATTGAAACGTCAATAAACCTCGCTTGGACAGCTGGCAGTAACAATACCTGTATTGGCATCGCTGCTAAATACAAGCTGGATTGTAGAACTTCTTTATCTGCCAAAGTAAATAATGCCAGCCTGATTGGACTTGGTTATACTCAGACCCTTCGACCAGGAGTCAAACTGACCCTGTCAGCTTTAGTCGATGGAAAGAACTTCAATGCAGGAGGTCACAAGGTTGGGTTGGGATTCGAACTAGAAGCTTAATGTGGTTTTGAATAAAGCATCAAATTTGTTCCTGGAGGTGAAGAGAAATGAATCCACTATGTTTTGGCCTTAAAATTCTTCTCTGAAATTTCAAAAGTGTGAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACGCTGAAGTCTAGAGATCGCAAGTCCACCCTAAGGGAGGTCCTTAAAGGCATGCCTGGAAGTTGTTATGTTTGTGCCACATTTCAGTTCCGCAGTATTATTTTAAATGTGTTCCTCGGCGACAATGTAGTGTCATGTTAAAGGAAATGACTCGATCCTCCAGTTTGTACATCACGTCCTGCATGTCCCACACCACTTTTTCATGACCGTTTAATATATTGGTCTGTGTGCTGTAGTGGAATCTTTGGTTTTGCATCAGGGTATAATAAAATAAACCCATCACATTTGAACATAATTGCTCATCTTACTTGCTAGTAGTGGTTTTCTTATATTTGGTGTGATTTGCTTTGAAAAGTACTCTCATAGGTGAGAGTATATGCCTAAAGTGGTATGTCTGAAACATCTATGCTGTCTCTTGCCTGTCCTTTGCACTTTAGATTACTTCACTCTTATTGCTGCTCTGCAGTTGGGCC