Transcript asmbl_42905

Sequence
Transcript Sequence for observation asmbl_42905 of TGE0012864:
GGGCGCACTGACTGGCAGAGTCGCAGACCCGTGGAGATGGCGACGCTCTGTCTGACCGTGAATTCAGGAGACCCTCCCCTGGGCGCTCTGCTGGCAGTAGAACATGTGAAGGACAATGTCAGCATTTCTGTTGAAGAAGGGAAAGAAAATGTCCTTCGTGTGTCTGAAAACGTGGTGTTTACGGACATAAATTCCATCCTGCGCTACCTGGCTAGAGTTGCAGCCACGGCTGGGCTCTACGGCGCCAACCTGATGGAACATGCTGAGATCGATCACTGGTTGGAGTTTAGTGCTACAAAATTGTCTTCATGTGATTTGTTTGCCGCTGCGATCCGTGAGCTCAGTCACTGCCTATCTCTGAGAACGTACTTGGTTGGAAACTCCTTGAGCTTAGCAGATGTGTGTGTTTGGGCCGCCCTGAAAGGAAACGCTGCATGGCAGGGACAGTTGGAGCAGAACCAAGCGCCAGTCCACGTAAAGCGCTGGTTTGGCTTTCTCGAAGCCCAGCAGGCCTTCCGGTCAGTAGGTGCCAAGTGGACTGTCTCAGCCACCAAAGGCAAAGCGGCACCTGAGAAAAAGCAGGATGTTGGGAAATTTGTTGAGCTTCCGGGTGCTGAGATGGGAAAAGTTACTGTCAGATTTCCTCCAGAGGCTAGTGGTTACTTACACATTGGGCATGCGAAAGCTGCTCTTCTGAACCAGCACTACCAGGTTAACTTTAAAGGGAAACTGATCATGAGATTTGATGACACAAATCCTGAAAAAGAAAAGGAAGATTTTGAGAAGGTGATCCTGGAAGATGTTGCGATGTTGCATATCAAGCCAGATCAGTTTACTTACACGTCAGATCACTTTGAGACGATAATGAAGTACGCAGAGAAGCTGATCCGGGAAGGGAAGGCATACGTGGACGACACTCCCGCCGAGCAGATGAAAGCTGAACGTGAGCAGAGGATAGAATCCAAACACAGGAGCAACTCTGTCGAGAAGAACCTGCAAATGTGGGAGGAAATGAAAAAAGGGAGCCAGTTCGGTCAGTCCTGTTGTCTGCGAGCCAAGATCGACATGAGCAGTAACAACGGCTGCATGAGGGACCCCACCCTGTACCGCTGCAAAACGCAGCCCCACCCGAGGACCGGAAGTAAGCACAATGTTTATCCCACCTACGATTTTGCCTGCCCCATCGTGGATAGCATCGAGGGTGTCACGCACGCCCTGAGGACCACAGAATACCATGACAGAGACGAGCAGTTTTACTGGATTATTGAAGCTTTAGGCATAAGAAAACCGTATATTTGGGAGTATAGTCGGCTAAATCTCAACAACACAGTGCTGTCGAAGAGAAAACTCACGTGGTTTGTCGACGAAGGACTGGTAGATGGATGGGACGACCCGAGGTTCCCTACGGTCCGTGGGGTCCTGAGAAGGGGGATGACAGTCGAAGGGCTGAAGCAGTTCATCGCTGCCCAGGGCTCCTCACGTTCGGTCGTGAACATGGAATGGGACAAAATTTGGGCATTTAACAAAAAGGTCATCGACCCGGTGGCCCCACGGTACGTCGCATTGCTGAAGAAAGAGGCGGTCCTGGTGAACGTCCCCGGAGCACAGGAGGAGAAGAAAGAAGTGGCCAAACACCCAAAGAACCCGGATGTGGGCTTGAAGCCCGTGTGGTACAGCCCCAGAGTTTTCATCGAAGGTGCCGATGCGGAGACGCTGTCGGAGGGCGAGATGGTGACATTCATAAACTGGGGCAACATCAGCATCACTAAGATACACAGAAATGCAGAAGGAAAAATTGTGTCTCTTGATGCAAAGTTGAATTTGGAGAACAGAGACTACAAGAAGACCACGAAGATCACTTGGCTGGCGGACACGGCGCGCGCTCCTCCCGTCCCAGCGGTCTGCGTCACGTACGAGCACTTGATCACAAAGCCGGTGCTGGGGAGGGACGAGGACTTCAAGCAGTTCGTCAACAGGGACAGTAAGCATGAAGAGCTGATGCTGGGAGATCCCTGCCTTAAGGATTTGAAAAAGGGAGACATTATACAGCTCCAGAGAAGAGGCTTCTTCATATGCGATCAACCGTATGAACCTGTCAGCCCGTATAGTTGCAGAGAAGCCCCGTGTGTTTTAATCTACATCCCTGACGGTCATACAAAGGAAATGCCGACGTCTGGGTCAAAGGAAAAGACCAGAGTAGAGTCAGCGAAGACTGAGACGCCGCCGCCTGCTAAGGGGAGGCCAGCGCCACCTGCGACTGGCTCCCGTGCTCCGTCCGAGGATCCCCTGGTCCTTTACACCAGAGTGGCTGCCCAGGGCGATGCGGTTCGTGATTTAAAAGCCCAGAAAGCGGCAAAGGAAGACATAGACGCGGCCGTGAAGCAGCTGCTGGCTTTGAAGGCCGAGTACAAGGAGAAAACGGGCCAGGAATACAAGCCCGGAGACGCTCCCGCGGCCACAGCACCGAGCGTCCCTCCCGCGTCCCCAGCAGCTGTCCCCGGGAGTCAGTCACTGTACGAGGAGGTCGCTGCACAAGGGGAGGTGGTTCGGAAACTGAAAGCCGAAAAGGCGCCCAAGGATCAGGTAGGCCCAGCCGTGCAAGAGCTGCTTCAGCTGAAGGCGCAGTACAAGGCGCTGACGGGAGCAGAGTACAAGCCTGTCTCCGCCGCCGGCGCCGAGGACAAAGACAAGAGAAAGAAAGAAAAAGAAAACAAATCCGAAAAGCAGAATAAGCCTCAGAAACAAAGTGACGGCCAGAAGAAAGACGCCTCCAAACAGCCGGGGAGCGGGCTGGCGTCCGGCGGCGCCGGAGAAGGGCAGGGGCCCCGCAAGCAGACCAGGTTGGGTCTTGAGGCAAAAAAAGAAGAAAATCTTGCAGATTGGTATTCTCAAGTCATCACAAAGTCAGAAATGATCGAATACTACGATGTAAGTGGCTGCTACATTCTTCGGCCGTGGGCGTATTCCATCTGGGAATTCATCCGAGACTTTTTTGATGCCGAGATCAAGAAACTTGGTGTTGAAAACTGCTATTTCCCCATGTTTGTATCTCAAGGCGCGTTAGAAAAAGAGAAGACTCATGTTGCTGATTTTGCCCCTGAAGTTGCCTGGGTTACAAGATCTGGCAAAACAGAGCTGGCAGAACCCATTGCCGTTCGCCCTACCAGTGAAACAGTCATGTATCCTGCATATGCGAAGTGGGTGCAGTCACACAGGGACCTGCCCATCAGGCTCAATCAGTGGTGCAATGTGGTGCGCTGGGAGTTCAAGCACCCGCAGCCTTTCCTGCGGACTCGAGAGTTCCTGTGGCAGGAAGGGCACAGCGCCTTCGCCACCTTCGAAGAAGCAGCGGAGGAGGTCCTGCAGATCCTTGACCTGTACGCTCAGGTGTACGAAGAGCTCCTGGCGATCCCCGTTGTGAAAGGAAGGAAGACCGAGAAGGAGAAGTTCGCTGGGGGCGACTACACCACCACGGTGGAGGCGTTCGTGTCCACCAGCGGACGAGCCATCCAGGGAGCCACATCACATCATTTAGGGCAGAATTTTTCCAAAATGTTTGAAATCATTTTTGAAGATCCAAGGACACCAGGAGAGAAGCAGTTTGCCTACCAGAACTCCTGGGGCCTGACCACGCGCACGATTGGTGTCATGACCATGGTCCATGGGGACAATGTGGGCTTAGTGTTACCGCCCCGCGTCGCCTGTGTTCAGGTGGTGGTTATCCCTTGTGGCATTACGAACGTACTTTCCGAAGAAGACAGAGATGCTCTGATCGCCAAATGCAGTGACTATCAGAGGCGGCTGCGCAGCGTCAACATTCGGGTCAAAGTCGATTCGAGAGATAATTATTCTCCAGGTTGGAAATTCAATCACTGGGAGCTCAAGGGAGTTCCGATTAGACTTGAAGTTGGGCCACGTGATATGAAGAGCTGTCAGTTTGTAGCCGTCAGACGAGATACTGGAGAAAAGCTGACAATTGCTGAAAACGAGGCCGAGACTAAACTTCAGGCCATTTTGGAAGACATCCACGTTAACCTTTTCACGAGGGCTTCTGAAGACCTTAAGACTCATATGGTTGTGGCTAATTCAATGGAAGACTTTCAGAAGGTGCTAGAGTCTGGAAAGATTGCTCAGATTCCGTTCTGTGGGGAAATCGACTGCGAAGACTGGATCAAGAAGACCACCGCCAGGGATCAGGACCTCGAGCCTGGCGCCCCGTCCATGGGCGCCAAAAGCCTTTGCATCCCCTTCCAGCCCCTGTGCCAGCTGCCGCCCGGGGCCAGGTGCGTCTGCGGCAAGAACCCCGCCCAGTACTACACCCTGTTCGGCCGCAGCTACTGAAGGATGAAACCGCACTCCTGTCTCCAGCCCGCCAAACTTCGTCAGACTCGGACTGCTCTCTCCCCAGATGTAGACAGTTTTATGATTTTTCTAAAATAAACGTTCTAAAGGGGGGGGCCGTGAAACAAACACCTATCCTTATGCCTCGGTTAGCAGTGGGGAAAAGCTTTTCTGTAAACCAGCCCAGTAATAAATATCATGAACTCA