Transcript asmbl_42891

Sequence
Transcript Sequence for observation asmbl_42891 of TGE0009510:
GGAGGAGGAGGACGAGGACGAGGAGGACGGGGAGAGAGGCTGCACCTTCCTGGTGGGCCTCATCCAGAAGCACCGGCGGCGGCAGAGGAAGATGGGAGAGGACATGCACACCATTGGCTTCGGCATCTACGAGGTTCCAGAGGAGTTGACGGGACAGACCAACATCCACCTCCCCAAAAACTTCTTCCTGACGCACAGAGCGAGGGAGCGGTCGGACACCTTCATCAACCTGCGGGAGGTGCTCAACCGCTTCAAGCTGCCCCCGGGGGAGTACGTCCTCGTGCCTTCCACCTTCGAACCCAACAAGGACGGGGACTTCTGCATCCGGGTCTTTTCTGAGAAGAAGGCCGACTACCAGGTGGTCGATGATGACATCGAAGGCAACCTTGACGAGATTGACGTCAGCGAGGACGACATTGATGACGGATTCAGGAGGCTGTTTGCCCAGCTGGCAGGGGAGGACGCGGAGATCTCTGCCTTCGAGTTGCAGACGATCCTGAGGAGAGTGCTCGCCAAGCGCCAAGACATCAAGTCAGATGGCTTCAGCATCGAGACCTGCAAAATCATGGTTGACATGCTAGACTCGGATGGCAGTGGCAAGCTGGGCCTGAAGGAGTTCTACATTCTCTGGACGAAGATCCAAAAATACCAAAAAATCTACCGGGAAATCGATGTGGACAGGTCTGGTACCATGAACTCCTATGAGATGCGGAAGGCGTTAGAAGAAGCAGGTTTCAAGCTGCCCTGTCAACTCCACCAAGTCATCGTTGCTCGCTTTGCAGATGACCAGCTCATCATCGATTTCGATAATTTTGTTCGGTGTTTGGTTCGACTGGAAACGCTCTTCAGGATATTTAAGCAGCTGGATCCCGAGAACACGGGAACGATACAGCTCGACCTTATCTCTTGGCTCTGTTTTTCAGTACTTTGAAGTGATGACTAATCTGCCTGAAGACTTCTTATGAAAGAAAATCAGCCACGGACTAAGCTTCCACTAAGCTTCCACGGAGAAACTTTTTATCTAGACCTTAATCATGGGAACATTTATGTAAACTGATGATTATAGTTGAAAATAATGATACCATTTGAGATAGAACTTTCAGATATCAAAGTAAAAGATTTGCATATCATTATACTCAATGCAAGTGAGTCGCTTAACCCTGGACAAGCTCAAAGCTTTAAATCTGTAAATGGTACCCACTTTGTACTTTTACACACAATCCTGTTTAGAGCAATATTAAATCAGGAAAAAAATGCAGGGAGGTATTTAACAGCTGGGCAAACATTCAGTCAATGTCAAAGGACACGAGGTCCTTGCTGGAAATATTGAAAGCAACTTCGAGTTTAAAAACGCTGCTGTGGCAGCAGCTCGGGGCTCACCATTTCCCTTGAGTAAAATGGAAAATATGATGCCTCATGAAGTAATCTTGTCAAGGCATCTGAAGAGGCCAGGTGAGAATGCTCGCCTCTGTCACTTGGGTTAGACAAGAGACAGGTTTTCTATAATACTGACTGGTTAACAGTAAATCTGAAACTCAAGTCCCTGAGTGTGCCTGGTCTTATACAGTGTTATAAATACCGGAGGGGTTCTAGTCATGGTCGGCTGAAGTGATACACTGAAACCAGGCGGCGTTTGCAGACGAGGTGTGGCTAAGACAAAACGAGCTGTTTGCTGCCGGCTTCGAAACGTCTCAAAAGTCTCCACCTCTGGTGTTTGTGCCCGGAGTTGGGACCCGGCCTGGGAGTACGCGTGGAAACAAAACGTGTTCCTTGGCTTTACTTTCTGAAAATTCTAACATTATAAAAATATTGCCTTGTTGCCTTACCTTCTACCGAACGTACTGTTAATAAAGAGTCTCCCAGGCAACC