Transcript asmbl_42583

Sequence
Transcript Sequence for observation asmbl_42583 of TGE0012848:
AAAACAGGAGGTAGAAAGTTCAGATCCGGGCTTCTCGAATGACCGCTCTGCTCCGCGTCTCGTTGGTTCCGGAGGTCGCTGCGGCTGTGGGAAATGCTGGCACGCGCAGCGCGGGGAACTGGGGCCCTTTTGCTCAGGGGCTCCGTGCAGACTTCTGGCCGTGCTTCGCGCCGCGCCTCCTCCGGATTGCCCCGGAACACCGTAGTACTGTTTGTGCCACAGCAGGAAGCCTGGGTGGTGGAGCGAATGGGCAGATTCCATCGGATCCTGGAGCCTGGCTTGAACATCCTCATTCCTGTGTTAGACCGGATCCGATATGTGCAGAGTCTCAAGGAAATTGTCATCAACGTGCCTGAGCAATCGGCTGTGACTCTTGACAACGTAACTCTGCAAATTGATGGAGTCCTTTACTTGCGCATCATGGATCCTTACAAGGCAAGCTATGGTGTGGAGGACCCTGAGTATGCTGTCACCCAGCTAGCTCAGACAACCATGAGATCAGAGCTTGGCAAACTCTCTCTGGACAAAGTCTTCCGGGAGCGGGAGTCCCTGAATGCTAATATTGTGGATGCCATCAACCAGGCTGCTGACTGCTGGGGCATCCGCTGCCTCCGTTATGAAATCAAGGATATCCATGTACCACCCCGGGTGAAAGAGTCCATGCAGATGCAGGTGGAGGCAGAACGGCGGAAACGGGCCACAGTTCTGGAGTCAGAGGGGACTCGAGAGTCGGCCATCAATGTGGCAGAAGGGAAGAAGCAGGCACAGATCCTGGCCTCTGAGGCAGAAAAGGCTGAACAAATAAATCAGGCTGCAG