Transcript asmbl_42255

Sequence
Transcript Sequence for observation asmbl_42255 of TGE0005446:
CGGGCCGGGCTTGATTAGTCAGGAGGCAGAGGCGCGCCGGCGGCGCCCGGAAGTAGCCGAAGCGAGCGGCGGAAGTAGCCGAAGCGTCCGGAGCGGGCGGGCGGCAAGGCGAGGCGAGAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAATGAGAATAAGCAAGAGCGGGACAAGGAGAACCGGCACCGGAAGCGCAGCCACAGTCGCTCTCGCAGCCGGGACCGGAAGCGCCGCAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGCAGCGCCTCCCGGGATAGGCGGCGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTCCGCAAGTACTGGGACGTGCCACCGCCTGGCTTCGAGCACATCACCCCTATGCAGTATAAGGCCATGCAGGCTGCGGGTCAGATTCCAGCCACTGCCCTCCTGCCCACCATGACTCCGGATGGTCTGGCTGTGACCCCGACGCCAGTGCCAGTGGTCGGGAGCCAGATGACCAGACAGGCCCGGCGTCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGTGAAATATTGTGGGGCTGAGATCCCTCGTAGCAACAAAAAGTTTGCTACCGTCGGCGAAGGAGGCCATGATGGACTTCTTCAATGCCCAGATGCGCCTGGGGGGGCTGACTCAGGCCCCTGGCAACCCCGTCCTGGCTGTGCAGATTAACCAGGACAAGAACTTCGCCTTCCTGGAGTTCCGCTCAGTGGACGAGACCACCCAGGCCATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCCCATGACTACCAGCCCCTGCCCGGCATGTCAGAGAATCCCTCTGTCTATGTGCCTGTCCGTTCCTTCCTCCTTCCCTCAGGAGTTGTGTCCACAGTGGTCCCAGACTCCGCCCACAAGCTGTTCATTGGGGGCCTTCCCAACTACCTGAACGATGACCAGGTGAAAGAGCTGCTGACATCATTCGGGCCTCTCAAGGCCTTCAACCTGGTTAAGGACAGCGCGACTGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGTGAGCCCCAGGCCCATGGCGCGGTTGTGTCTGCCATTGCCTTTACCCTGCTCTGTGTCCACCCGGAGGTCTCCCCTTGGAGTTGGGGAGGAGGCAGCCAGCAGTGGCAGGGCCTGCCTGGGGCTTCCCAAGCTCTTGGCCCCTTGCCTTCCCTTCTTTCCCTTCCAGTGCCCAGCTCTGGGATGCTAGGGTTCAGGGGTGGCGTCGGGCTCCTGGTCCCTGACCCACACCTCTTCCCTACATTCCCCCATCGTCCCTCCAACGTAGGCTATTGCGGGGCTGAATGGGATGCAGCTGGGTGACAAGAAACTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCTGTGACCCTGCAAGTGCCCGGCTTGATGAGCTCCCAGGTGCAGATGGGTGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGTGATGAGTGCAGCAAGTATGGGCTGGTCAAGTCCATTGAGATCCCCCGGCCCGTGGATGGTGTCGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGTCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTACCACCGCAGGGACTTCTGGTAGAGGCGGTGGGGGAGGGTGGGGCCGGGCTGGCGTAGGGCTTCTGCCCTGCCACCCCCCCTTTTTCCCCCTCTGAAGACATGGGCAGAGGAGTGACAGCCGAGTGACAGCCGGCAGCAACTGGAATGGCAGCAATTTAAGGGTGGGGG