Transcript asmbl_42254

Sequence
Transcript Sequence for observation asmbl_42254 of TGE0005446:
GTTCATGTTTGGTTATATCAGAAAAATAAAAGGCAGGGTGCAGATCAGGCTAGAGTCCACTCTGAGGCTCTCTCCTTATTGCCCCAATTGCCTCTTGTCTTCAGGAGTGTGGTGACGTTCGTGAGCACGAGAATGGGGCCTGGTGGGTAGTTCAGGAATCAGGGGTGTCTTTGAACCCAGGAAGTAAAGTAGAAGGCAGAGTTCAAGTTCCCCATGCTTGGGGTTTAGCCTGCACCTCCTCCCGTGGCTGAGAGCCCTGTTGGGAGCACAGGTTTCTGTGGCTTTGCTGGCAGGGCAAGCCCAGCCAGCCCGTAGTGTACTGTGTGCTTGGCTTTGAGGCAGGATGGGCTGTCCTGGGGTTCAGGTCTGTGTGGGGTGAAAAGGGGCCTCAGGGTGGGCATCCTGGTTGGGAAGGGACGGGTGGGGTTTCCCTGCTTCCTGCCCGGCTCCCAACCCTGGGCCTGACAGTGGGACTGTGGGCGCATCTGGTTGATTGAAGAGGTCTTTCCTGAGGGGCCGTGGGTCCTTTCAGGAAAACATCATTGGGTCTCTTGGTTCCCCAGCCTCTAGCCCTGCCCCTCTCAGGGACGACCCTGGGGTCAGGCCCCTCAGCCCTCGAGGGGGACCAGGAGCCAGCCTCCTCTGTCTTCTCTGGCTCCCCAGCTCCTCCTGAGCAGCCTCAGAGCGGGACAAGGAGAACCGGCACCGGAAGCGCAGCCACAGTCGCTCTCGCAGCCGGGACCGGAAGCGCCGCAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGCAGCGCCTCCCGGGATAGGCGGCGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTCCGCAAGTACTGGGACGTGCCACCGCCTGGCTTCGAGCACATCACCCCTATGCAGTATAAGGCCATGCAGGCTGCGGGTCAGATTCCAGCCACTGCCCTCCTGCCCACCATGACTCCGGATGGTCTGGCTGTGACCCCGACGCCAGTGCCAGTGGTCGGGAGCCAGATGACCAGACAGGCCCGGCGTCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGACTTCTTCAATGCCCAGATGCGCCTGGGGGGGCTGACTCAGGCCCCTGGCAACCCCGTCCTGGCTGTGCAGATTAACCAGGACAAGAACTTCGCCTTCCTGGAGTTCCGCTCAGTGGACGAGACCACCCAGGCCATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCCCATGACTACCAGCCCCTGCCCGGCATGTCAGAGAATCCCTCTGTCTATGTGCCTGTCCGTTCCTTCCTCCTTCCCTCAGGAGTTGTGTCCACAGTGGTCCCAGACTCCGCCCACAAGCTGTTCATTGGGGGCCTTCCCAACTACCTGAACGATGACCAGGTGAAAGAGCTGCTGACATCATTCGGGCCTCTCAAGGCCTTCAACCTGGTTAAGGACAGCGCGACTGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGTGAGCCCCAGGCCCATGGCGCGGTTGTGTCTGCCATTGCCTTTACCCTGCTCTGTGTCCACCCGGAGGTCTCCCCTTGGAGTTGGGGAGGAGGCAGCCAGCAGTGGCAGGGCCTGCCTGGGGCTTCCCAAGCTCTTGGCCCCTTGCCTTCCCTTCTTTCCCTTCCAGTGCCCAGCTCTGGGATGCTAGGGTTCAGGGGTGGCGTCGGGCTCCTGGTCCCTGACCCACACCTCTTCCCTACATTCCCCCATCGTCCCTCCAACGTAGGCTATTGCGGGGCTGAATGGGATGCAGCTGGGTGACAAGAAACTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCTGTGACCCTGCAAGTGCCCGGCTTGATGAGCTCCCAGGTGCAGATGGGTGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGTGATGAGTGCAGCAAGTATGGGCTGGTCAAGTCCATTGAGATCCCCCGGCCCGTGGATGGTGTCGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGTCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTACCACCGCAGGGACTTCTGGTAGAGGCGGTGGGGGAGGGTGGGGCCGGGCTGGCGTAGGGCTTCTGCCCTGCCACCCCCCCTTTTTCCCCCTCTGAAGACATGGGCAGAGGAGTGACAGCCGAGTGACAGCCGGCAGCAACTGGAATGGCAGCAATTTAAGGGTGGGGG