Transcript asmbl_42250

Sequence
Transcript Sequence for observation asmbl_42250 of TGE0012839:
CGGGCCGGGCTTGATTAGTCAGGAGGCAGAGGCGCGCCGGCGGCGCCCGGAAGTAGCCGAAGCGAGCGGCGGAAGTAGCCGAAGCGTCCGGAGCGGGCGGGCGGCAAGGCGAGGCGAGAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAATGAGAATAAGCAAGAGCGGGACAAGGAGAACCGGCACCGGAAGCGCAGCCACAGTCGCTCTCGCAGCCGGGACCGGAAGCGCCGCAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGCAGCGCCTCCCGGGATAGGCGGCGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTCCGCAAGTACTGGGACGTGCCACCGCCTGGCTTCGAGCACATCACCCCTATGCAGTATAAGGCCATGCAGGCTGCGGGTCAGATTCCAGCCACTGCCCTCCTGCCCACCATGACTCCGGATGGTCTGGCTGTGACCCCGACGCCAGTGCCAGTGGTCGGGAGCCAGATGACCAGACAGGCCCGGCGTCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGACTTCTTCAATGCCCAGATGCGCCTGGGGGGGCTGACTCAGGCCCCTGGCAACCCCGTCCTGGCTGTGCAGATTAACCAGGACAAGAACTTCGCCTTCCTGGAGTTCCGCTCAGTGGACGAGACCACCCAGGCCATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCCCATGACTACCAGCCCCTGCCCGGCATGTCAGAGAATCCCTCTGTCTATGTGCCTGGAGTTGTGTCCACAGTGGTCCCAGACTCCGCCCACAAGCTGTTCATTGGGGGCCTTCCCAACTACCTGAACGATGAC