Transcript asmbl_41755

Sequence
Transcript Sequence for observation asmbl_41755 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGTGAGTACCTCAGGGACAGGCAGCCCCACTGCTCTGGGCCATGCTGGAGTCTGCAGATGTAGAGCGTGGCCCCAGGTGACGCTGTGCCCCTGGGGACGTGAGCTGAGCTGGAGGCACGCAAGTCCCGAGAAACGCACTCTGCACCACGTCAGTGTCAGAAGCCCAAGCGCCAGTGTCCTCCACACTGCGGTCCCGCAGTTGAGATGAGTCAGGAAGCCAAGGAGCTGCTCCCAGTCGGGGAGGAAGACTTCATGGCAGGCCGCCTCGTCCCCAGGGCTGTCACCTGTTCTGTAGGAAGGGACCTTCTCACTGGGGCGGGGTGAGGGAGCTCCGATGGGGTCGATGCGTTCGGTCCCCACCGTTAGAGAGGACCCCTTCTTGTGCAGGCACCTGGGAAGGGGCTCGGCCTGGGGTCAGCGTGGCAGAGGTGGCAGTGGCTGGGACCCTGGACCGGGCCTCAGGCTCTCCCACTGTGATCCCAGGGGACGGCGGGTGCTGCCCCTTCATGGGATCGGTGCCAGACAGGGAGTGCTTGCCGCGACCTGCCCGTGAGCTGGGAGGTGGAGCGTTTCTTTCCTGGGGGTGGATGGACTCCCTGAGAAAGGGAGCTTTCTCGCCAGAGAGGAATGTAGGACGCCGAAGCAGCTCAAGGCAGAGGAAGGGGAGCTGGGGAGGGCGCAGCTGGCTGCAGAGCTGAGCCGTGTCCTGGTTGGCGGGCGTTAGGCCCCACTGACCCCTTGCCGGGCAACCGACAGTGTCCTGGGT