Transcript asmbl_13372

Sequence
Transcript Sequence for observation asmbl_13372 of TGE0000147:
CTTTTCTTCACTTCCGTTGAGTTCCGCCTCGCCGTTTGTCCCTTGCGGTACCCGTCCGCATACGAATCTAGCCCGGGAACCGAGTTGCGGGAGTGCGGTCTGTGCCGTTCCGGCCAGGAGTTTGCCGACTGCAGACGTCCTGCGAACCGGCAAGATGTGCTCTCTGGGGTTGTTCCCTCCTCCACCGCCTCGGGGTCAAGTCACCCTATATGAGCACAATAACGAGCTGGTGACGGGCAGTAGCTATGAGAGCCCGCCCCCCGACTTCCGGGGCCAGTGGATCAATCTTCCTGTCCTACAACTGACAAAGGATCCCCTAAAGACCCCTGGAAGGCTGGACCATGGCACAAGAACTGCCTTCATCCATCACCGGGAGCAAGTGTGGAAGAGATGCATCAACATTTGGCGTGATGTGGGCCTTTTTGGGGTGCTAAATGAAATTGCAAACTCAGAAGAAGAGGTGTTTGAGTGGGTGAAGACGGCATCCGGCTGGGCCCTGGCACTCTGTCGATGGGCCTCTTCCCTCCATGGGTCCCTGTTCCCCCATCTGTCTCTCAGGAGCGAAGATCTGATCGCTGAATTTGCCCAAGTCACAAATTGGTCCAGCTGCTGCTTGCGTGTCTTTGCATGGCACCCCCACACCAACAAGTTTGCAGTGGCCCTGCTAGATGACTCAGTCCGTGTGTATAATGCCAGCAGCACCATAGTCCCCTCCCTGAAGCACCGGCTGCAGCGAAATGTGGCGTCTCTGGCCTGGAAGCCCCTTAGTGCCTCTGTCTTGGCTGTGGCCTGCCAGAGCTGCATTCTTATCTGGACCCTGGACCCTACCTCCTTGTCTACCCGACCCTCTTCTGGCTGTGCCCAAGTGCTGTCTCACCCTGGGCATACACCTGTTACCAGCTTGGCCTGGGCCCCCAGTGGGGGGCGGCTGCTCTCAGCTTCACCCGTGGATGCTGCTATCCGG