Transcript asmbl_41750

Sequence
Transcript Sequence for observation asmbl_41750 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGCAGGAGAGCACGATCCAGACGATGGAGCTGCGGCACGCCTTCTCCCTGTACTGCCTGCACCAGGAGACGCAGCTGGTCCACGCCCACCTGCCCCTCACCTCCCACATCCTCGGGGCCTTCGTCAACTCCCAGATCCAAGGGCACAAGGAGATGAGCAAGGTGTGGGACGACCTGAAGCCCAAGCTGCACTGCCTCTTCGCTGGACCCAACAGCACCTGACCCTGCCAGGGTCCCCAGGGATGGCCTGTCTCCTCACTAGTGCTGCGAGGACCCGGGGCGCAAAACCCACCGGCGCCCTCACTAAAACTTCTTTCCAAACGGTGTGTCCCTGTTTGATTCCCTTCAGAGAGCAGCTGTCCCCCATGTCCCGCGGGCTGCCGCCCTCAAGCAGGAGAGCTGACGTCAGGGCTGGCAGGTCCGGTGCGACGGCGCAGAGCCGAGGACACGGCTGTGGGCTCAGGCTGTGGCCGTCCTGGCCCAGCGCTGTGGCCTGAGGCTTGTGCTGGAAAGCGTCGGCCCCTGGGATGGCTTCCCCTGGGACCTGGAGGCCAGCGTGCGGCAGAGGTTTTCACAGCACACGGTGCCCGGGGGGTGCAGGGGCCCTGTGCTGGAGCAGCCGGAGAGGGAGGCCGAAACCCTGTGGAGGGCAGGAATGTCCCTGCGGTGGCATGTCACCCTGGATGAGGCACAACTGATGAGTGAGAGGGCAGTCCTGGGCGGGGGGTGAGTGTGCGAGGCGGCTGCTGGGGCCAGCAGGGCAGGTGCAGCTGGG