Transcript asmbl_41567

Sequence
Transcript Sequence for observation asmbl_41567 of TGE0012811:
CGGACCGCGGCGCTGGCCCGCTGAGCTAGTTCCTGCTGGGTCTGGGTCGCCGTCGCCGCCCGGGTCCTGTCGCCTGATGGTCCGCCTGTGAGGCGGGCTGCCGGCTGACGTCTCCTCGCGATGGAGCACATCCGTACGACCAAGGTTGAGCAAGTGAAATTACTTGACCGATTCAGTACCAGCAACAAGTCATTGACAGGGACACTGTATCTTACAGCCACACACCTGTTATTTATAGACTCTCATCAGAAGGAAACCTGGATTTTGCACCATCATATTGCCTCAGTAGAGAAACTGGCTCTGACGACTTCTGGGTGCCCACTTGTGATTCAGTGCAAGAACTTCAGGATTGTGCATTTCATTGTTCCCAGAGAAAGAGATTGCCATGACATTTACAACTCTTTGCTACAACTGTCAAAACAAGCAAAATATGAAGATCTCTACGCATTCTCTTATAATCCCAAACAAAACGATTCAGAACGACTGCAAGGCTGGCAGCTCATTGACCTCGCTAAGGAATACGAGAGGATGGGAGTGCCAAATTCAAACTGGCAGCTGTCGGATGCCAACCGAGAGTACAAGATTTGTGAAACTTATCCCAGAGAACTCTATGTTCCTCGAATAGCAAGCAAGCCAATCATCGTGGGCAGTTCCAAGTTCCGGAGCAAGGGGAGGTTCCCGGTGCTTTGCTACTATCATCAGCATAAGGAGGCTGCCATTTGTCGGTGTAGTCAGCCACTGTCAGGATTCAGTGCCCGGTGCCTGGAGGACGAACATTTGCTTCAAGCCATTAGTAAGGCCAACCCGGTCAACCGCTACATGTACGTCGTGGATACCAGGCCCAAACTGAATGCAATGGCCAACAGAGCAGCTGGAAAAGGTTATGAAAATGAAGATAACTATTCTAATATTAGATTTCAGTTTGTTGGAATTGAAAATATTCATGTCATGCGGTCCAGCCTTCAGAAATTATTGGAAGTCAGTGGTACCAAAGGGCTTTCTGTCAATGATTTCTACTCCGGTTTGGAGAGCTCGGGTTGGCTTCGCCACATCAAAGCTGTAATGGACGCTGCAATCTTCTTAGCCAAAGCAATAATGGTTGAAAATGCTAGTGTGTTGGTGCATTGTTCTGATGGCTGGGATAGGACTTCCCAGGTGTGTTCCCTCGGCTCCCTGTTATTGGATTCCTACTACAGGACGGTCAAAGGATTCATGGTCTTAATAGAAAAGGATTGGATCTCCTTTGGACATAAATTTTCAGAGCGGTGTGGCCATTTGGATGGTGACCCAAAGGAAGTCTCACCGGTGTTTACTCAGTTCTTGGAATGTGTGTGGCATTTGACCGAGCAATTTCCACAAGCCTTTGAATTCAACGAAGCGTTTCTTCTTCAGATCCATGAACACATTCATTCGTGCCAATTCGGAAACTTCCTTGGAAATTGTCAGAAGGAAAGAGAAGAACTCAAGTTGAAGGAGAAGACGTACTCCCTGTGGCCGTTTCTTCTGGATGACCAAAAGAAGTACTTCAATCCTCTGTACAAGTCTCAGAAATTGGCAGTTTTGGAGCCAAATACAGTATCTTTCAATTTTAAGTAAGTTGGCGTCATCAAAGTGTTTATATTCTATTTTTCTCATGCACAGTTCA