Transcript asmbl_41052

Sequence
Transcript Sequence for observation asmbl_41052 of TGE0005379:
CCCCCCAAGCCAGTCGCGCTGCTGCGCAGCTCCCATAGCGGTTACCTCCGCCGGAGACGGTTGGGAGAACCGTTGTGGGCAGGGCTCCACCAGTCAAGAGACTTCTTCCTTACGACTGGACCTCGCAAGCACCGCAGTCGGCGCTGCTGTCGCTCGACAGGGTATCTGAAGTAAAAGGGGCATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAG