Transcript asmbl_41050

Sequence
Transcript Sequence for observation asmbl_41050 of TGE0005379:
GGGTGGGCAGAGCGCCTTGGAAGGGATGAGGGTGGGGAACGAAGCGAGCAGGGGAAGGCCGGGCACTTGGGTGCGGGGAGGTTCTGGGCTGGCGGGCGCGCTCCCGATGGAAATGGCGCCATATGGGCCTAGCCTCCCACCGCGGCCTCCCTTCCTCCGCAGTCTCGGCAGGGCTACCTGGGCTGGCGGGATTGCGAGTGACTTCTGACGCAGATTCTCAAGATGAGAGAGGCTGGACCTGGGGGAGGAAAGTCAATGGCGACGAAGGCGCTCAACTCCCAAATCCAGGACAAAGGAGGCAGACGGCTTCCTTTGTAATTCCGCCGCCCGGTGGCGAAGGTTTCTAAGCCTGGCTTTGGCTGCCGGCCGGGGAGGAGGGGAAAGGAGAGTACTCTCCCTAGCTCTCTGGTCTCTAGGACAGCTAGATAAACGAAAAGTCTCCGGGGAGGAATAAAGGACGCTTAGCCTGCCCTTATATTCCAGATTTGGAACTTCGAAAAGACATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAG