Transcript asmbl_41022

Sequence
Transcript Sequence for observation asmbl_41022 of TGE0005367:
TTGACACGCACAGATAGAACCTAAAGAAAGGCAAAGAGTCCTGCCCGGCACCGGCGCCGTGCGGGCCGAACCTGCGCCCGGGGAGCGGCGCGCAGAGGGCACCGGGCGCCGGGAGCAGGCGGCGCAGCACCAGCATTGTGTAGTGTTGGGAGGTCACTGTGTAAGCAAGCTGAGAGGGAAACTGAGGCAAGATGTCGGGCCGGAGCGGGAAGAAGAAAATGTCTAAGCTGTCCCGTTCAGCCAGGGCTGGTGTCATCTTCCCAGTGGGGAGACTGATGCGTTACCTGAAGAAAGGGACATTCAAGTACCGGATCAGCGTGGGTGCTCCCGTATACATGGCAGCAGTCATCGAGTACCTAGCAGCGGAAATTCTAGAATTGGCTGGGAATGCCGCAAGGGACAACAAGAAGGCCCGCATAGCCCCAAGACACATCCTGTTGGCAGTTGCCAATGATGAGGAGCTCAATCAGCTGCTAAAAGGAGTGACCATCGCCAGTGGAGGTGTCCTGCCCAGAATTCACCCTGAACTGCTGGCCAAAAAGCGAGGGACCAAAGGCAAGTCGGAAACCATCCTCTCCCCGCCCCCAGAGAAAAGGGGAAGAAAGGCCACGTCAGGAAAGAAGGGGGGCAAGAAATCCAAGGCTGCCAAACCACGGACGTCCAAAAAGTCCAAAGCAAAGGACAGTGATAAAGAAGGAACTTCAAATTCCACTTCTGAAGATGGGCCAGGGGATGGATTCACCATTTTGTCTTCTAAGAGCCTTGTTCTAGGGCAGAAGCTGTCCCTGACCCAGAGTGACATCAGCCATATTGGCTCTATGAGAGTGGAGGGCATTGTCCACCCAACCACAGCCGAAATTGACCTCAAAGAAGATATAGGTAAGGCCTTGGAAAAGGCTGGGGGAAAAGAGTTCTTGGAAACAGTAAAAGAGCTCCGCAAATCCCAGGGCCCTTTGGAAGTTGCTGAAGCCGCCGTCAGCCAATCCAGCGGACTTGCAGCTAAATTTGTCATCCACTGTCACATCCCTCAGTGGGGCTCCGACAAATGTGAAGAGCAGCTTGAAGAGACCATCAAAAACTGCCTGTCAGCGGCAGAGGACAAGAAGCTAAAGTCTGTTGCCTTCCCACCCTTCCCCAGTGGCAGAAACTGCTTCCCCAAACAGACGGCCGCCCAGGTAACCCTCAAAGCCATCTCAGCCCATTTCGACGACTCAAGTGCATCCTCGTTGAAGAACGTCTACTTCCTGCTCTTCGACAGCGAGAGCATCGGCATCTACGTGCAGGAGATGGCCAAGCTCGACACCAAGTAGCCGCCTCAGCCACGGCTGCACTTTGCAACAGGAGTCGGAGGAAAATCAAAGTCGTAGGAGTTGGTTTTGTTTTTTAAAAGGAAAGAGGAAGGGTGCCGCAGGGGAGTGGAGGGCAGCTGAAGGGAAGCGGGTGGCAAAGGCTGCAGGAGCAGGTCCCGCCTACAGAAGGAGCCCTTTGCATTTTATATTGTTAAAAAGATCCTCAATCCTAAAAACCAGGTCTCCACGAGGGGTCTTTCCATGTGTTTTCCCCCTGTTGTTTTAGAACTTTTTAAAAAAACAGACTTCGTTTTAGATTTATAGCACTGACTTTTACACACACACACACACACAC