Transcript asmbl_10737

Sequence
Transcript Sequence for observation asmbl_10737 of TGE0000016:
TGTTGCTGCCGCTGCCGCCGCCGCTTCATTGCACATTCAAGTGGAAAATTTTCAGGAGTCAGCAGAAACATTGTGTCCAAAAAAGACTGAGTCGCAGTTACCACCAAACCCAGGAGGAGACTCTCCCTGGAAAACTTCCCTTCCCTTTCGGTTTATTTTCTTGAAAAGGCTCCAGGCTTCGGCTTGGAAAATCCCACCGCCAAAATTGAGCCCAGCAGCTGGAGCGGCAGTGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTGCAGATAAGCCAATTGACAATGATGCAGAAGGGGTCTGGAGCCCCGACATCGAGCAAAGCTTTCAGGAGGCCCTGGCTATCTATCCACCATGTGGGAGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGCAAGACGAGGACCAGAAAACAGGTGTCTAGTCATATACAGGTCTTAGCAAGAAAGAAAGTTCGAGAAATTCAAGCCGCCATTAAGGTAACAAGCATGGATCAGACTGCAAAGGATAAGGCCCTGCAGCACATGGCGGCCATGTCCTCAGCCCAGATCGTCTCGGCCACTGCCATTCATAACAAGCTGGGGCTGCCTGGGATTCCACGCCCGACCTTCCCAGGGGCGCCGGGGTTCTGGCCGGGAATGATTCAAACAGGGCAGCCAGGATCCTCACAAGACGTCAAGCCTTTTGTGCAGCAGGCCTACCCCATCCAGCCAGCGGTCACAGCCCCCATTCCAGGGTTTGAGCCTGCATCGGCCCCAGCTCCCTCAGTCCCTGCCTGGCAAGGTCGCTCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTTTCAGCTTTTCTCGAGCAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATTGGGCATGCCAACCATTCTTACAGTGACCCATTGCTTGAATCAGTGGACATTCGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTGTTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTCGTAAAATTCTGGGCTGATTTAAACTGCAATATTCAAGATGATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTACGAGAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTTTGCTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACGGAGTATGCAAGGTTTGAGAATGGCCGATTTGTATACCGAATAAACCGCTCCCCAATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACAAGAAACTCTACTCTGCATGGCCTGTGTGTTTGAAGTTTCAAATAGTGAACACGGAGCACAACATCATATTTACAGGCTTGTAAAGGACTGAACATGGTTATTTATATATATAGATATCTGTATATACACACACACATATGTGCACACACACACTCTCTCTCCATTATCGAACGACTGACTGTAAACCTCACCACACAGGGTGGTGCCCTGGCCCCGAGGTCACCCCGACTTTTCTAAATCTTGTTTGAGTGAAGTCATTTTTTCATGTGTTCATACTATCATTGTAGCTGTGAAGTTCTGGTACAGTTGTAAAAAGAGAAATTGAGTTGTTTCTCTATGTTCTTCAGATGTGCAGCCCACAATTCCTCGGGAAAGGTGAACCTGAACAACCCAAGTCTCTCTCTGCAGAGCCCTGTTTCTAATTGTGGTAGAAAATATTGAGACAGAGCATTTGCCATGGGACATTTACAGCCTTTATACAAATGTATTTAGTTCTCTTTTTTCCAACATAAAATTCTTGTTTTAAGATACAAGTAAAATTAATCTTTAAATATAAATGTAAATTAGTACACAAAACTAAGAA