Transcript asmbl_4001

Sequence
Transcript Sequence for observation asmbl_4001 of TGE0005329:
CGGCGGTGGCAGCGGCGGCGGTGGCAACGGCGGCAGCTGTGAAGGTGTTCCGGGAAGATGGTGCTGATCAAGGAATTTCGTGTGGTTTTGCCCTGTTCTGTTCAGGAGTATCAAGTTGGGCAGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGTGGAGAAGGAATTGAAGTCTTAAAGAATGAACCTTATGAGAAGGATGGAGAAAAGGGACAGTATACACACAAAATCTATCACCTAAAGAGCAAAGTTCCTGCATTCGTGAGGATGATTGCTCCCGAGGGCTCCTTGGTATTTCATGAGAAAGCCTGGAACGCATACCCCTACTGTAGAACAATTGTAACGAATGAATATATGAAAGATGATTTCTTCATTAAAATTGAAACATGGCACAAACCAGACTTGGGAACATTAGAAAATGTACATGGTTTAGATCCAAACACATGGAAAACTGTTGAAATTGTCCACATAGATATTGCAGATCGAAGTCAAGTTGAACCAACAGACTACAAAGCTGATGAAGACCCAGCATTATTCCAGTCAGCCAAGACCAAAAGAGGCCCTTTGGGACCCAACTGGAAGAAGGAGCTGGCAAACAACCCAGACTGTCCTCAGATGTGTGCCTATAAACTGGTGACCATCAAATTCAAGTGGTGGGGACTGCAAAGCAAAGTAGAGAACTTCATTCAAAAGCAAGAGAAAAGGATATTTACAAACTTTCATCGCCAACTTTTTTGTTGGATTGACAAGTGGATTGATCTGACAATGGAAGACATTAGGCGAATGGAAGATGAAACTCAGAAAGAACTAGAAACAATGCGTAAGAAGGGTTCCGTCCGAGGCACGTCGGCTGCTGATGTCTAGATGAGTCCCCTGTAGGGTCAGAGACAATATCAAACTGTTTACGTAATCAAGGTCAAGTAAGGGGAACAAGTGCAGCCAGTGATGAGTGAAGAAGAATCTGAACAGTATCTTGCAGTATTGGTGTTTCCCAGACGTGTGCTTGTGACTATCTAGTCACATGCACAGGTTCCCAGCCATGTGTGTATATATGTTTGTGTGTGTATATCCGTAGCTGTATATAAAATGCATGTAGAGCTACAGATCAGAATACACACACGTGTATATATATGTACATATAAACATACCGAAGGGATTAGTACAATTTCTCTTAAGTACTGTACCTATCTTCAGCAAGAATGCAAAAGAATATTTTCAATATGTATACCTGGAACAGATTTTAATAATCAGAGTAATATCATGAATGGACAAATTGACTGCAGTGTGATACTAGCTAGTATGTTTCATAAATGTCAAGTTGTGGACCAATATATACATATATAAATATATAGCCTTTTATTACTTTCCTTTTAAATCAGTCTCTTATAAATTTTTATTTCAGTCTCATAAGCAACAGACGCCCACAGAAAAATTATTCAAAATCTTTTTGCTATCAGCGAACGTAAACTCTGAATGTACATATAACGGTTTCTTTCTGGATGGTCATTATCTTACAGCCAAATTGGACAATATCTATTAGTAAGGAGTAAAGTTATAGGCCAGTTTTTACTTGTTTGCTTTGAGGGACAAAATCCTTTTAAAAAATTACTGGTTTTTATTGGATTTTTGTATTTAAATTTCAAGTATTTTTCTACATCAGACACAGCAAAAATGAGATGATGGTTTGTGATGTATAATAAACACGATACAATTTTTAGGCTCCTGTGAGTCAAACAAAGAAATTAATGAAGAAATTAATAGCATTGTAGGCTGTTTAGAAAAATTGGAAGTACAAGTGCTTCCACAGAGTCTTGTTTTTGAAATGACTGTTTTCTGAAATTACAGCTTGGAAACTATGCAAATGATTTAGATTCCTCACAGCTTACACGATAGACTATAGATAGTGATGATGTTTTGCTCTTTTCATGTTGAAACACACTTTAAGGGGGAGATGCTGACTTTGAATTAGGAAGAATTTAAGAGGCAGCTTGAGGCTCGCCTGCACACAGGAGGCCCTGCCCAGGAGCCGGTGCACCTCCACCCATTTGGCTGTGCTCTCAAGGAGGATGTCGTTGGAACATACCCTGAATAAGCATCGTGAAAACGCTGGTTAGAAGCTGCTGCTGCTGCCTTATTTTATTTTATTTTTTAAGAGAGGAACAATAGGTAAGATTTTTATCAGCTTTCTCTGTCCAAGTCCAGTTTTTCTCCTGTCAGTCCTGAAAGCTTGAATAGAATGATATTGTTGAAGCCTTCAGGTCACAAACTGTCGTCTTAACCTCTCGTCCCTCCTACAACACGCCAGCCCCTGTAGTCACATCACATTAGTAATCTGATTTGCTGACAGTCCTCCCCCCCCGCCCCCGCTTCTCTTTTCCCACATGTCCTGTGTCCCCAACAAAGTGATCGTAGTGACTGAGACAAGGATGTCTTCTGCATTACGATACCCTGTTATCCTCAGCCACAAACCCCACATTGCATATGTCCTCTGTGTACTCAGGATCAAGACTGATGTTTACTCTCTGGGCGCTATTGTAAGATAGGTTTTGTCAACACATAATCATTGTCTGCAAAGTGATGCAAGGAAGGAAGATTATTGCTAATTTTGTGAAATAAAGAGTCTAGCCCTCTCCTTTTAATGAACTTAACTCTCGCTGGCATCTGTAGCATCATTGGGAGCTTGGGCACACATGGAAATGAGAACCCAGCGCATGGATTTTAATGTTTTTCTAACAACTGTGGAGATTTGAGGGAATGTGTGGTGAATGTAAAATATCTAGTTTACTTGGCAGTCTCTTGTGTAAATTACAGTAAAATAAAGTAAATGAAATTTAAACAAAAAATAAATTTGATCACAAAATGC