Transcript asmbl_39994

Sequence
Transcript Sequence for observation asmbl_39994 of TGE0005298:
GTCGGGACGTGCTGTGGTTCTCACTTTCCGTCATGGCGTTGAAGGTGGCGAAGGCCGTCGGCGGCTCTGCGAAGGCAGTGCTCAGGCCGGCACTCCTCTGCCGTTCTTGGGAGGTTCGAGGTGCCCACGACGCCCCCCAGAGGAGCTTCTCAGTAAGTACCTGCCTAGGTGTGTGTGCGTGACGATATGTGTGTGCTCGCACGTATGTATATTTGCGTTTGTGCATGTGTGCACCCGTCTGTGTGCATACATAGGTGTGTGTATGTACTGTGCGTGCACGCACAACATATGTACACATGTGTGCGTGTGCTCGTGTGTGTGCCGTGTCTTCTTGCTCCTTGGCCCTCCGTGTCCTTCCCTTTATGGCACATTCTCCAGAGGTCACCCACCCGTCCTCCTTACCTCCTTACCTGAACTGTGCTAGACAGCATCTCACGGAAAAGGCACAGCCTTGTTCCTCCAACCTTGGCTGATCCGAGTCTTCTTCCTTCCTGTTCTCACTCTAGCAACAAACAATTCCTCCATCTGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGACGGCATCGGGCCGGAGCTCATGCTGCACGTCAAGTCTGTCTTCAGGCATGCGTGTGTGCCAGTGGATTTTGAAGAGGTGCACGTGACCTCCAATGCTGACGAAGAGGACATCCGCAACGCCATCATGGCCATCCGTCGGAACCGCGTGGCCCTGAAGGGCAATATTGAAACAAACCATAACCTGCCGCCGTCTCATAAATCCCGCAACAACATCCTTCGCACTAGCCTGGACCTCTATGCCAACGTCATCCACTGTAAGAGCCTGCCGGGAGTAGTGACCCGGCACAGGGACATAGATATCCTCATTGTCCGGGAAAACACAGAGGGCGAGTATAGCAGCCTGGAGCATGAGAGTGTGGCAGGAGTGGTGGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAATACGCCTTCAAACTGGCCCAGGAGAGCGGGCGCAAGAAAGTGACAGCCGTGCACAAGGCCAACATCATGAAACTGGGCGATGGGCTCTTCCTCCAGTGCTGCAAGGAGGTGGCAGCCCGCTACCCCCAGATCACCTTTGAGAATATGATCGTGGACAACACCACCATGCAGCTGGTTTCCCGGCCCCAGCAGTTCGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAACGTCTGCGCAGGGCTGGTTGGGGGCCCTGGCCTCGTGGCTGGGGCCAACTATGGCCATGTGTACGCCGTGTTCGAGACGGCTACAAGGAACACAGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCACAGCTACGCTGCTGGCGAGTTGCATGATGCTTGACCACCTCAAGCTACACTCCTACGCCACGTCTATCCGCAGGGCCGTCTTGGCATCCATGGACAATGAAAACATGCACACCCCAGACATCGGGGGCCAGGGCACCACATCGGAAGCCATCCAGGACATCATCCGCCACATTCGCATCAGCAACGGCCGGGCCGTGGAGGCGTAGACTGCCCCCCTCCCCTCTCAGCACCCCAGCTGGCTTGTTGGGTGGACCCAGAATAAATCAGTTTCTGCCCCAGCCCTCA