Transcript asmbl_39990

Sequence
Transcript Sequence for observation asmbl_39990 of TGE0005296:
CAGGGCCGGAGTGAGAGAGTTTGGCGGCAGTAGCGGGGCGTGTGAGGTGTCGGTGGGAGGCTCGGAAACAAGCTCACTTCTCCCTGTTGGAAATCCAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCAGAGGTCTTTCTCGTGCTGCTTCTCTGCATTCCCTTCATTTCACCCAAAAGATGGCAGAAGATTTTCAAGTCCCGCCTGGTGGAGTTCGTAGTGACCCATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGCTGGTCATTGATGCTCTGCGTGAGATTCGGAAGTATGATGACGTGACAGAGAAGGTGAATCTCCAGAACAACCCTGGGGCCCTGGAACACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCCGGCTTTTCTCTGCTGCTGTCCTTCCTGCTTAGACGACTGGTGACTCTCATCTCCCAGCAGGCCACTCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCAGAGAGCGCTAGTGAGGCGGCCAAGAAGTACATGGAAGAGAATGACCAGCTGAAGAAGGAAGCTGCTGTCGGTGGCGTTGAGTTGAGTGCCAGGGAGGTGACTTTGGAGTTAGAGACCAGTAACCTGAAGGCCGATCTGAAGAAGCTGAAGGATGAGCTGGCTATAAACAAGCAAAAACTAGAGAAAGCTGAAAACGAGGCTCTGGCCATGCGGAAGCAGTCCGAGGGCCTGACCAAGGAGTACGACCGCCTGTTGGAGGAGCACACGAAGCTGCAGGTGGCAGTAGATGGTCCCACGGACAAGAAGGAGGAGTGAGGGCCCCTCCCGCCCGTGGCCTGGCCTGAGCTCGAGCTCGCCACTTCCCGAGAGCCAGGCCTCTCTGGGCACTTGCACTTCCCACCCCTCACACTGCCTACAGTTCATTGTTCTCCCAGCGCCCCCCAGAGGACCGGGCTCCCACCTACTCAGGATGCATTTGTCACCAGCTTGGCTATCCAGGAGCATGGTGGGCCCCTGGAACCCTCGTGATGGGTCTTGCTTCTTGCTGGGCGGAGCCCCTTTTTTTGTTGCACGTTGATGTTTGGGCTCCAAGTCCCCTTTTCTCTGCTCCTGCAGGAGGGTGGGCGAAGCAGGCAGAGTTTCTGTTGGGGGCAATAAAGGTTATTATGATGTG