Transcript asmbl_39651

Sequence
Transcript Sequence for observation asmbl_39651 of TGE0012714:
AGTGTGCGTGGAGATTAGGTCCGAGCGCCCGCCCCGAGGCAGGCAGTTCGCGAGCTCAAGCCGCCGCCGCCGCCAGCAGCCACCTTCGCAAGCAGCGCCGCGGCGGAACCGGGCGCAGGGGAACTAGCCCGGCCCCGCCAGTCCAACCCAGCCCAGCCCGACTCCCTCCCCACGCCGAGGCAGCCGCTGCCGCCAGGAGAGAAGGTGGAGGAAGAAATCCAGCCCCTAGCACGCGCGCACCATCATGGACCATTATGATTCCCAGCAAACCAACGACTACATGCAGCCCGAAGAGGACTGGGATCGAGACCTGCTACTGGACCCGGCCTGGGAGAAGCAGCAGAGAAAGACATTCACGGCGTGGTGCAACTCCCACCTCCGCAAGGCGGGGACGCAGATCGAGAACATCGAGGAGGACTTCCGGGACGGCCTGAAGCTCATGCTGCTGCTGGAGGTCATCTCAGGTGAACGTCTGGCCAAGCCGGAGAGAGGCAAAATGAGGGTACATAAGATCTCCAATGTCAACAAGGCCCTGGACTTCATAGCCAGCAAAGGGGTCAAGCTGGTGTCCATTGGAGCGGAAGAAATTGTGGACGGGAACGTGAAAATGACCCTGGGCATGATCTGGACCATCATCCTCCGCTTCGCCATCCAGGACATCTCTGTGGAAGAGACTTCGGCGAAGGAAGGGCTGCTCCTGTGGTGTCAGAGAAAGACAGCCCCTTATAAAAATGTCAACATCCAGAACTTCCACATAAGCTGGAAGGACGGCCTTGGCTTCTGTGCCTTGATCCACCGACATCGGCCTGAGCTGATTGACTATGGGAAGCTGCGGAAGGATGATCCACTCACAAATCTGAACACGGCCTTCGATGTGGCAGAGAAATACCTGGACATCCCCAAGATGTTGGATGCTGAAGACATCGTTGGGACCGCCCGACCAGATGAGAAAGCCATCATGACTTACGTGTCCAGCTTCTACCATGCCTTCTCCGGAGCCCAGAAGGCGGAGACAGCAGCCAATCGTATCTGCAAGGTGTTAGCTGTCAACCAGGAGAATGAGCAGCTCATGGAAGACTACGAGAAGCTGGCCAGTGATCTGCTGGAGTGGATCCGCCGTACCATCCCGTGGCTGGAGAACCGGGCGCCCGAGAACACCATGCACGCCATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGCCTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCTGCCTTCATGCCCTCCGAGGGCAGGATGGTCTCGGACATCAACAATGCCTGGGGCTGCCTGGAGCAGGCAGAGAAGGGCTATGAGGAGTGGCTATTGAACGAGATCCGGAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACGGACGGCAAAGAGGCCATGTTGCGGCAGAAGGATTACGAGACGGCCACGCTTTCGGAGATCAAGGCCCTGCTCAAGAAACACGAGGCCTTTGAGAGTGACCTGGCTGCCCACCAGGACCGCGTGGAGCAGATTGCTGCCATCGCACAGGAGCTCAATGAGCTGGACTATTACGACTCACCCAGTGTCAACGCCCGGTGCCAAAAGATCTGTGACCAGTGGGACAATCTGGGGGCCCTAACCCAGAAGCGGAGGGAAGCCCTGGAGCGGACTGAGAAACTGCTGGAGACCATTGACCAGCTGTACTTGGAGTATGCCAAGCGGGCCGCACCCTTCAATAACTGGATGGAGGGGGCCATGGAGGACCTGCAAGACACCTTCATCGTGCACGCCATTGAGGAAGTCCAGGGACTGACTACAGCCCATGAGCAGTTCAAGGCCACCCTTCCTGATGCCGACAAAGAGCGCCTGGCCATTCTAGGCATCCACAACGAGGTGTCCAAGATTGTCCAGACCTACCACGTCAACATGGCCGGCACCAACCCCTACACAACCATCACGCCTCAAGAGATCAATGGCAAATGGGACCATGTGCGGCAGCTGGTGCCTCGGAGGGACCAGGCCCTGACGGAGGAGCACGCCCGCCAACAGCACAACGAGAGGCTACGCAAGCAGTTTGGGGCTCAGGCTAATGTCATCGGGCCCTGGATCCAGACCAAGATGGAGGAAATTGGGAGGATCTCCATCGAGATGCACGGGACCTTGGAAGACCAGCTCAGCCACCTGCGGCAGTACGAGAAGAGCATCGTCAACTACAAGCCCAAGATTGACCAGCTGGAAGGGGACCACCAGCTCATCCAGGAGGCACTCATCTTTGACAACAAGCACACCAACTACACCATGGAGCACATCCGTGTGGGCTGGGAGCAGCTCCTCACCACCATCGCTCGGACCATCAATGAGGTGGAGAACCAGATCCTGACCCGGGATGCCAAAGGCATCAGCCAGGAGCAGATGAACGAGTTCCGGGCCTCCTTCAATCACTTCGACCGGAAGAAGACAGGCATGATGGACACGGATGATTTCCGCGCCTGCCTTATCTCCATGGGTTACAACATGGGAGAGGCAGAATTTGCCCGCATCATGAGCATT