Transcript asmbl_39601

Sequence
Transcript Sequence for observation asmbl_39601 of TGE0005280:
GTCAGTTGTGGACAGACGTAGGCGAGTTGTGTCCTGGTCTGCGGGGAGGTAGAGGACTCCGTCGCAGACTACGGACCTCTCTTGGGTCTCAGCTGCCAAAGATCCTGTCCGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGGTGGAATTTGGAGGGGGGTTGGGTTGGGCTGGATTATCTTTGTAGATGTGGACCACCAGGGGGTTGTTGAAAACTAATTGTATTAAATTGTCTTTTGATAAGCCTTCTTCTCACATTTTTGTGAATGTCTGAAGTATATAGTTTGTGTATATTGACAGAGCTCTTTTATAACTAAAGCGAATTTAATTTTTTTGTACTAGCAAAAATTTGAACATTTTAGTGCCTGGTTATTCAAATATGTTAATTAAGAATTAGTTTAATGCCTCAATTAAACTAATTAATAGCTTTGGATACTTAAAAGAGCTCTAAATTTGCTTGTACATAGAGGCTTACTGAGTTTTCCTTGTTAGGGTCAAGGGTGTCCTCCCACCTACCCTTTAACAGCTGCTTGGCAAAGACGTTAAAGCAGCTGTTTGTTATTGATAATAAAAGATGATAAAACTGC