Transcript asmbl_13360

Sequence
Transcript Sequence for observation asmbl_13360 of TGE0000145:
GGGCGGGAGCACCCACATCATCCAACAGGTTGGTCAGGCTGGGAGGCGTCCCGCCCTCCTGCAGCTAATGAGCACTGTGCAACAGGTGTCTGCTCCTCAGTCCCCAGCCCGCCCCAGCTGTGACCAGAGCAACCAGAGCCTGCCACCCGACGCAACCCCAGGCTCACTCGCTCACCCCCCTGGGCCCTCCTGCTTCCGGCCGGGGGCACCATGGCCTGCCGCTCCTGCGTGGTTGGCTTCAGCAGCCTCAGCAGCTGTGAGGTGACCCCGGTGGGCAGCCCCCGGCCTGGAACCTCAGGATGGGACAGCTGCAGGGCCCCCGGGCCGGGCTTCAGCTCCCGCAGCCTCACAGGCTGCTGGTCGGCTGGCACTATCTCCAAGGTGACTGTGAACCCCGGCCTGCTGGTGCCCCTGGATGTCAAGTTGGACCCCGCTGTTCAGCAGCTGAAGAACCAGGAGAAGGAGGAGATGAAGGCCCTCAATGATAAATTTGCCTCCCTAATTGGCAAGGTGCAAGCCCTGGAACAGCGCAACCAGCTGCTGGAGACACGCTGGAGCTTCCTGCAGGGCCAGGACTCAGCCATCTTCGACCTCGGGCATCTCTATGAGGAATATCAGGGCCGGCTGCAGGAGGAACTGCGCAAAGTGAGCCAGGAGCGGGGGCAGCTGGAGGCCAACCTGCTGCAGGTGCTGGAGAAGGTTGAGGAGTTTCGAATCAGGTATGAGGATGAGATCTCCAAGCGCACAGACATGGAGTTCACCTTTGTTCAGCTGAAGAAGGACCTGGATGCAGAGTGTCTTCATCGGACTGAACTGGAAACCAAGTTAAAAAGCCTGGAGAGCTTCGTGGAGTTGATGAAAACCATCTATGAGCAGGAGCTGAAGGACCTGGCAGCACAGGTGAAGGATGTGTCGGTGACCGTCGGCATGGACAGCCGCTGCCACATCGACCTGAGCGGCATCGTGGAGGAGGTGAAGGCCCAGTATGACGCCGTCGCGGCTCGCAGCCTGGAGGAGGCCGAGGCATACTCTCGGAGCCAGCTGGAGGAGCAGGCCGCCCGCTCGGCCGAGTATGGGAGCAGCCTCCAGAGCAGCCGCAGCGAGATCGCGGATCTCAATGTGCGCATCCAGAAGCTGCGGTCCCAGATCCTCTCTGTCAAGAGCCATTGCCTGAAACTGGAGGAGAACATCAAGACAGCTGAGGAGCAGGGTGAGCTGGCCTTCCAGGATGCCAAGACCAAGCTGGCCCAGCTGGAGGCCGCCCTGCAGCAGGCCAAGCAGGACATGGCGCGGCA