Transcript asmbl_39598

Sequence
Transcript Sequence for observation asmbl_39598 of TGE0005280:
GTCAGTTGTGGACAGACGTAGGCGAGTTGTGTCCTGGTCTGCGGGGAGGTAGAGGACTCCGTCGCAGACTACGGACCTCTCTTGGGTCTCAGCTGCCAAAGATCCTGTCCGGTAGGTGAGTGACTCACTTTGAGGGAATGGCTTCTCGGATCGAGGCTTCTTCATGGCCACTCAGATCGCGAGTGGCCAGGGCTGCTCTCTTTGCGGAGGACGGCGTCCAATGAGCGCAGTTTACTCGAGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGGTGGAATTTGGAGGGGGGTTGGGTTGGGCTGGATTATCTTTGTAGATGTGGACCACCAGGGGGTTGTTGAAAACTAATTGTATTAAATTGTCTTTTGATAAGCCTTCTTCTCACATTTTTGTGAATGTCTGAAGTATATAGTTTGTGTATATTGACAGAGCTCTTTTATAACTAAAGCGAATTTAATTTTTTTGTACTAGCAAAAATTTGAACATTTTAGTGCCTGGTTATTCAAATATGTTAATTAAGAATTAGTTTAATGCCTCAATTAAACTAATTAATAGCTTTGGATACTTAAAAGAGCTCTAAATTTGCTTGTACATAGAGGCTTACTGAGTTTTCCTTGTTAGGGTCAAGGGTGTCCTCCCACCTACCCTTTAACAGCTGCTTGGCAAAGACGTTAAAGCAGCTGTTTGTTATTGATAATAAAAGATGATAAAACTGC