Transcript asmbl_38197

Sequence
Transcript Sequence for observation asmbl_38197 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTACATCCATATAAGAATCCAGCAACGGAACGGCAGGAAGACACTGACCACTGTTCAGGGCATCGCAGATGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGTAATGGTACTGTGATTGAACATCCTGAATACGGAGAGGTTATTCAGCTTCAAGGTGACCAAAGAAAAAACATTTGCCAATTTCTGTTGGAGGTTGGCATTGTCAAGGAGGAACAGCTTAAGGTTCATGGATTCTAAAATGAACCTAGATACGTGGAGAATTTCTTGAATAATTTTGTTCTCTAAATCCAGTTTGGCTGCCTTGTGAAATGATTCTCTGCAGTAAACGGACTTTTCATTTATTTAATCATTCAGATTTCCATTTACATCTGCATGACTACAGAAAACATGGGGTATGTAGGCTAGTAACACATAAGAAAATTGCAGTAAGATGGTAATGAAACCCCGTATTCATCTTAACATGTTTCCAATGGAAAATATTTTGTTTTGAGTGTTTATTTGTTTATTGTTCAGTTTATTACTTTTCACTTGATTAAATGTTTTTTTGTTGTATTAAACCATGTATGTTGCAGCTTAACAATAAAAATATGAATTCTTTTGTGAGCAGTTAGGCTCCCAAATTTAAGCAAGTAAGATACCCATACATTTTGTCTTTCATAATTGGAGTTCTCATTCTGAAAGTATTCTAATTAGATTCAGCTGCTGTTAAACCCAAAGCTAGAAGAGAACCTTTGTTAAAAGTAGCTTGTGTTCTTCATTTACTGACTTAAAATAAGAATAGAATCGCGTATAAACTCAGCTAGAGCCAAGAATCTGTCACAGTGTTAAATTTTAAAAAATAATGTGAAGTATAATTTAAACTTAAGTATTAGCACATAGAAT