Transcript asmbl_37915

Sequence
Transcript Sequence for observation asmbl_37915 of TGE0005201:
CCAGAGTGGAGCACCGCGAGGCGCTGAGGGGAACGCTGGCTGTGACACGAGCTCTGGGACTGGGGTCTGTGGCTGGCCCCTCGCTGGCCCTGTCTCCCAGCCCCAGACAGGTACTCACCTGGGGAGTCTGAGCTTTGGCTACTCCCTTTGCCCGTGACACGATGTTCCCCTTCTACAGCTGCTGGAGGACTAGATTACTGCTGCTGCTACTGCTGGCTGTGACGGTGAAAGAATCCTGGCAGGCAGAAGAGAAAACCTGTGACCTGGTAGGAGAAAAAGGTAGAGAGTCAGAGAAAGAGTTGGCTCTACTGAATAGGATGAAACCACTGTATAACAAAAGCTTTGAGAGCACTGTGGGCCAGGGCCCAGACAAGTATATGTACATATTCAGAGTGTGCCGAGAAGCTGGCAACCACACCTCTGGGGCAGGCCTGGTGCAGATCAATAAAAGTAATGGGAAGGAGACAGTGGTGGGGAGACTCAACGAGACTCACATCTTCAATGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAATCACTGTGGCAGGGAGCAGCGCCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGAGGCAAAATCCAAGATTGTTTATACCTCTTTGAGATGGATAGTAGCCTGGCCTGTTCTCCTGAGATCTCCCACCTCAGTGTGGGTTCTATCTTACTTGTCACGTTTGCATCTCTGGTTGCTGTCTATATCATCGGGGGGTTCCTATACCAGCGACTGGTGGTAGGAGCCAAAGGAATAGAGCAGTTTCCTCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGTTGCGACTTCGTGTGCCGTTCTAAACCTCGAAATGTGCCTGCTGCATATCGTGGTGTGGGGGATGATCAGCTGGGGGAGGAATCAGAAGAAAGGGATGATCATTTATTACCAATGTGATTGCACTTTAAATGCCCAGCTTCTTCAGCCCCCCGCCCAGACCAAAGCATACTCAGCCAGATTTCTGAAGCAATCTCTCTACTCCAGTCTCTCCTCTCACCCTTAATGTTGCTCTTGCTTTCCAGTTTGCTTTTGGTTTGCATCCTCTTCTCACTAGTTGATATGCCTTCCCTTTTTCCTTATTTTTGGTTTTTCCTCAAGAGGTAGAGTTGTAGGTCAGAGGTTAACAGGGCCAGTGACAAGAGGCTATTGCACTGTCTTGGTACAGGAGGGTACAGTTAGGATCATTTTAATGAGCAAAAGCATGTGGCAGGCTTGCTGACCCTTTTTTAAACACATTTTCACAAGTTCTTGAGACACTGGATTTCTTTAATT