Transcript asmbl_37723

Sequence
Transcript Sequence for observation asmbl_37723 of TGE0012635:
TTCCCTCACTCCTCCTTGCCCATCCTTTTTACTAATAATCTCACTGTGTTTCACCGCAAGCATTGGAGCTGGTGAAGGAAGCCATCGACAAGGCCGGCTACACGGAAAAGATTGTCATTGGCATGGATGTCGCTGCCTCGGAATTTTATCGTGATGGCAAATATGACTTGGATTTCAAGTCCCCTGCTGACCCTTCCCGATACATCACTGGGGACCAGCTGGGGTCCCTCTACCAGGACTTTGTCAGGGACTATCCTGTAGTCTCCATTGAGGACCCCTTTGACCAGGATGATTGGGCTGCCTGGTCGAAGTTCACAGCCAATGTAGGGATCCAGATTGTGGGTGATGACCTGACAGTGACCAACCCAAAACGTATTGAGCGGGCAGTGGAGGAAAAGGCCTGCAATTGTCTGCTGCTCAAGGTCAACCAGATCGGTTCGGTCACTGAAGCCATCCAAGCGTGCAAGCTGGCTCAGGAGAATGGCTGGGGGGTCATGGTGAGTCATCGCTCGGGAGAGACTGAGGACACGTTCATCGCGGATCTGGTGGTGGGGCTGTGCACAGGCCAGATCAAGACTGGTGCCCCATGCCGTTCTGAGCGTCTGGCTAAGTACAACCAGCTCATGAGAATTGAAGAAGAGCTGGGGGATGAAGCTCGCTTCGCTGGACACAATTTCCGCAATCCCAGTGTGCTGTGATCCCTCTACTTGCCTGAGACTTGGATCCCCCTCCCATCCTCCTGGAACCCCTTCCTGTCCTGCTCTGTGATATTTCACCCCAGACACCCTGGCTGACCTGCTGCACTGCTCCTGGGCTTGTCTCTCTCCTGCTCTCTCTGCTCTTCCTCTCTGGGTTCCACACACTCCACTTCTTTCTTATTCTTTCTCCTCAAAGACTGGTCCATGGGACTGATGATTATAAGGGGTCCATGGAAGAATGATCAGGGTCTGTGATGGGAGAATCAGGGTTGGTCGTTGAGGTCTTTAGAGAGGGGCCATGTGTCACTTGTGCTTTGTTCTGGTTCTGTGTGTTTTCTGTGTTGCATATGAGCCAGGCACTGCATGGTGCTGAGGTGGTGGAGAATGCTGGCTGTGTGGTCATGCCTGGCCTAAGGCTTTAGTGTGTTATTTATTTATTTGTTTGTTTATTTGTTTATTTATTTCCCATCCATCCCATTAATTAATCATTTCCCCATAACTCCAGGGCCAAAAACTGGTCTGACTGGAGGGTACTATGTGTCTGCATTTCATGTGGCTGTAGATTCTGAGATGGCTTGGGGTGGGAGGTCTTGCTGGAATGCAAAGGGTAAGAGAAAAGGGCCTTGCAGGCAGTTCCTTTGTATGTACCAATCCCTTCACAGAAGCCTGGCTCTGGCCAGAGGTGGGGCTGTGCTCCTGGGGGCTCTTCCCTGAGAACTCTCCCCAGCCCTAGCTTTCCTATTCTTCCTCCAGCTGCACCAGAGCAAATGTCTCACTCCCCCATGCCATGTTCCACAGTTGCTGCCACCTCTGTGGCGTTGAAATGAGCACCACCATTAAAGTCTGAATCAGTGCATTCTTGTGTCTGAGGAGTCCTGCTGTAGTCCCTATGAGGGGAGAGAAGATGGAGCACCGAGAAGGAAGTTGGTGAAACTAGATAGCAGAGTTGGGGAGAACATAAAAG