Transcript asmbl_36754

Sequence
Transcript Sequence for observation asmbl_36754 of TGE0005114:
CGGCCGGCGAGGGGAGGAGGCGGCCCTAGCGCCATTTTGTGGGAGCGAAGCGGTAGCTGGGCTGCTCCTGGATCCCTGGCTGCTCCGCGTCTCCGTGTCGGGCTTCCTAGCAGCAGCCTAGCGGAAAAATAAAAGATGTCTGAATATATTCGGGTAACCGAAGACGAGAATGATGAACCCATCGAAATACCATCAGAAGACGATGGGACAGTACTGCTTTCCACAGTTACAGCTCAGTTTCCAGGGGCCTGTGGGCTGCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTGGAAGGAATTCTGCATGCCCCGGATGCTGGCTGGGGAAATCTGGTATATGTTGTCAACTATCCCAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTTCAGAAAACATCTGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACTGAACAAGATCTAAAAGAATATTTTAGTACCTTTGGAGAAGTTCTTATGGTTCAGGTCAAGAAAGATATTAAAACTGGTCATTCAAAAGGCTTTGGCTTTGTTCGATTTACGGAATATGAAACCCAGGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGTAAACTTCCTAATTCTAAGCAAAGCCCAGATGAACCTTTGAGAAGCAGAAAGGTGTTCGTTGGGCGTTGTACGGAGGACATGACTGCTGATGAGTTGCAGCAGTTCTTCTGCCAGTATGGAGAAGTGGTAGATGTCTTCATTCCCAAACCGTTCAGGGCTTTTGCCTTTGTTACATTTGCAGATGATCAGGTTGCCCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTACATATATCCAATGCTGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTCGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAACAGTAGGGGGGGCGGAGCTGGCTTGGGAAACAATCAAGGTAGTAATATGGGTGGGGGGATGAACTTTGGTGCTTTTAGCATTAATCCAGCAATGATGGCTGCAGCCCAGGCAGCACTGCAGAGCAGCTGGGGTATGATGGGCATGCTAGCCAGTCAGCAGAATCAGTCAGGCCCATCAGGTAATAACCAAAGCCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTTGGTTCTGGAAATAATTCTTATAGTGGTTCTAATTCAGGTGCAGCAATTGGTTGGGGATCAGCATCAAATGCAGGGTCAGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAACCTTCTAGCTGGGGAATGTAGACAGTGGGCGATGGTTGTATAGACTGGTGGGAATTCAAATTTTTCTAAACTCATGGTAAGTATATTGTAAAATACATATGTACTAAGAATTTTCAAAATTGGTTTGTTCAGTGTGGAGTATATTCAGCAGTATTTTTGACATTTTTCTTTAGAAAAAGAAGAAGAGCTAAAGGAATTTTATAAGTTTTGTTACATAAAGGGTTGAAATATTGAGTGTTTGAAAGTGAACTGCTGTTTGCCTGATTGGTAAACCAACACACTACAATTGATATCAAAAGGTTTCTCCTGTAATATTTTATCCCTGGACTTGTCAAGTGAATTCTTTGCATGTTCAAAATGGAAACCATTGATTAGAACTACATTGTTTTCTCCTTGTTTTAATTTGAACCCCACCGTATGGATTTTTTTCCTTAGGAAAACTCTCCGTTTTGGAGATCATGGTGTCACAGTGTTTGGTTCTTTTGTTTGTTTTTTAACACTTGTCTCCCTTCATATACAAAAGTACAATATGAAGCCTTCATTTAATCTCTGCAGTTCATCTCATTTCAAATGTTTATGGAAGAAGCACTTCATTGAAAGGAGTGCTGTAAATGCTCTGCCATAGGAATCCTTCCGCCTACATGCTTTCTCATTCAGGAATTTGTCATCACGCTGCACAGGCTGCGTCTTTGACGGTGGGTGTCCCATTTTTATCCGCTACTCTTTATTTCATGGAGTCGTATCAACGCTATGAACGCAAGGCTGTGATATGGAACCAGAAGGCTGTTTGAACTTTTGAAACCTTGTGTGGGATTGATGGTGGTGCCGAGGCATGAAAGGCGAGTATGAGCGAGAAAAGGAGAGCGCGTGCAGAGACTTGGTGGTGCATAATGGATATTTTTTAACTTGGCGCGATGTGTCTCTCAATCCTGTGGCTTTGGTGAGAGAGTGTGCAGAGAGCAATGATAGCAAATAATGTACGAATGTTTTTTGCATTCAAAGGACATCCACCTCTGTTGGAAGACTTTAAGTGAGTTTTGTTCTTAGATAACCCACGTTAGTTGAATGTGTTAAGTGAAACGATACTTGTATTTCCCCTACCCCTTTGTCAACTGCTGTGAATGCTGTATGGTGTGTGTTCTCTTCTGTTACTGACCTGTAAGTGTGGTAATGTGAACTGAAGCTGATGGGTTGAGAACATGGACTGAGCTTGTGGTGTGCTTTGCAGGAGTACTTGGAAGCAGAGTTCACCAGTGAGCTGGGGGTGTCTCAAAGAAGGGTGGAAGTTCTAATGTCTGTTAGCTACCCATAAGAATGCTGTTTGCTGCAGTTCTGTGTCCTGTGCTTGGATGCTTTTTATAAGAGTTGTCAATGTTGGAAATTCTTAAATAAAACTGATTTAAATAATATGTGTCTTTGTTTTGCAGCCCTGAATGCAAAGAATTCATAGCAGTTAATTCCCCTTTTTGACCCTTTTGAGATGGAACTTTCATAAAGTTTCTTGGCAATAGTTTATTTTGCTTCAAATAAACTTATTTGAAAAGTTGTCTCAAGTCAAATGGATTCATCACCTGTCATGCATTGACACCTGATACCCAGACTTAATTGCTATCTGTTCTTGCATTGTCCAAAGTGA