Transcript asmbl_36499

Sequence
Transcript Sequence for observation asmbl_36499 of TGE0005094:
AGGAAACCGGAAGTAGCCTCTCTCCCGGTGGCTCCTACGCGGTTAACGGATCCTCAGTGGACGCTGGCTGCGCGCCAAGGTAGTCAACGTGATACCTGCAGAGAGTGACTTCGGGGTTAAGGGTGGTGCTGGACGTCAGGAGCCAACATGGCAGCGGTGGTCGGAGTCTCCTTGAGGCGTCGATTCCCAGCCACAGCCTTTGGCGGAGCCTGCCTGCAGGCCTGCCGAGGGGCCCAGACAGCTGCAGCCACAGCTCCCCGAATCAAGAAATTTGCCATCTACCGATGGGACCCAGATAAGACTGGAGATAAACCTCATATGCAAACTTATGAAATTGATTTGAATAAATGTGGCCCCATGGTGTTGGATGCTTTAATCAAAATTAAGAATGAAATCGATTCTACCTTGACCTTCCGAAGATCATGCAGAGAAGGGATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACGCTGGCTTGCACCAAAAGGATCGACACCAACCTCAACAAAGTCTCAAAAATCTACCCGCTTCCACATATGTATGTGATAAAAGATCTTGTTCCTGATTTGAGCAACTTCTATGCTCAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCCCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGCGAGAAACTGGATGGGCTCTACGAGTGCATCCTCTGCGCCTGCTGCAGCACCAGCTGCCCTAGCTACTGGTGGAATGGAGACAAGTATTTGGGGCCTGCGGTTCTTATGCAGGCCTATCGCTGGTTGATTGACTCCAGAGACGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCGTTCTCTCTGTATCGCTGCCACACCATCATGAACTGCACACAGACCTGCCCCAAGGGGCTGAATCCAGGGAAAGCTATTGCTGAAATCAAGAAAATGATGGCAACTTACAAGGAGAAGAAGGCGTCAGCTTAATTGTTCTCACACCAAACGTGACTTGCAACCAGCTCAGCTGGACATAACTTACATCTAATTTGGGTTCTTTCAGAGGTCTTCACTGTCCATGAATACAGCATGTATAATAAAACTTTTAAGAAATAAATAAA