Transcript asmbl_13349

Sequence
Transcript Sequence for observation asmbl_13349 of TGE0000143:
GTACCAGAAAGCAGCTGAAGAAACAAACATGGAGAAGAAGAGAAGTAACACCGAAAATCTCTCCCAGCACTTTAGAAAGGGGACCCTGACTGTGTTAAAGAAGAAGTGGGAGAACCCAGGGCTGGGAGCAGAGTCTCACACAGACTCTCTACGGAACAGCAGCACTGAGATTAGGCACAGAGCAGACCATCCTCCTGCTGAAGTGACAAGCCACGCTGCTTCTGGAGCCAAAGCTGACCAAGAAGAACAAATCCACCCCAGATCTAGACTCAGGTCACCTCCTGAAGCCCTCGTTCAGGGTCGATATCCCCACATCAAGGACGGTGAGGATCTTAAAGACCACTCAACAGAAAGTAAAAAAATGGAAAATTGTCTAGGAGAATCCAGGCATGAAGTAGAAAAATCAGAAATCAGTGAAAACACAGATGCTTCGGGCAAAATAGAGAAATATAATGTTCCGCTGAACAGGCTTAAGATGATGTTTGAGAAAGGTGAACCAACTCAAACTAAGATTCTCCGGGCCCAAAGCCGAAGTGCAAGTGGAAGGAAGATCTCTGAAAACAGCTATTCTCTAGATGACCTGGAAATAGGCCCAGGTCAGTTGTCATCTTCTACATTTGACTCGGAGAAAAATGAGAGTAGACGAAATCTGGAACTTCCACGCCTCTCAGAAACCTCTATAAAGGATCGAATGGCCAAGTACCAGGCAGCTGTGTCCAAACAAAGCAGCTCAACCAACTATACAAATGAGCTGAAAGCCAGTGGTGGCGAAATCAAAATTCATAAAATGGAGCAAAAGGAGAATGTGCCCCCAGGTCCTGAGGTCTGCATCACCCATCAGGAAGGGGAAAAGATTTCTGCAAATGAGAATAGCCTGGCAGTCCGTTCCACCCCTGCCGAAGATGACTCCCGTGACTCCCAGGTTAAGAGTGAGGTTCAACAGCCTGTCCATCCCAAGCCACTAAGTCCAGATTCCAGAGCCTCCAGTCTTTCTGAAAGTTCTCCTCCCAAAGCAATGAAGAAGTTTCAGGCACCTGCAAGAGAGACCTGCGTGGAATGTCAGAAGACAGTCTATCCAATGGAGCGTCTCTTGGCCAACCAGCAGGTGTTTCACATCAGCTGCTTCCGTTGCTCCTATTGCAACAACAAACTCAGTCTAGGAACATATGCATCTTTACATGGAAGAATCTATTGTAAGCCTCACTTCAATCAACTCTTTAAATCTAAGGGCAACTATGATGAAGGCTTTGGGCACAGACCACACAAGGATCTATGGGCAAGCAAAAATGAAAACGAAGAGATTTTGGAGAGACCAGCCCAGCTTGCAAATGCAAGGGAGACCCCTCACAGCCCAGGGGTAGAAGATGCCCC