Transcript asmbl_36464

Sequence
Transcript Sequence for observation asmbl_36464 of TGE0005083:
CTGGCCCCTACAGCGGTTAGTGGCGGCGGGAGCTGAGGAAGTAGGTGGGCCGGGTCGCGCCGCCTCCGGTGCCGGCCGTCCCTCCGTCTACCTTTCCGCCGCGGGCTCACCATGCCGCAGTATCAGACCTGGGAGGAGTTCAGTCGCGCGGCCGAGAAGCTCTACCTCGCCGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAGTTTGTGTATTAAAGTAACAGATGATTTAGTTTGTTTGGTGTATAGAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAACTAATGCGACTTATGGTAGCCAAGGAATCCCGCAGTGTTGCCATGGAAACAGACTGAATGGTTTGAAATGAAGACTGTTTGACATGTTCTTAGGAGTAAACATCTTTTGAATTTGAGGAAGTGTTGGGACAGAAAATACTTTATGTAACTAAGTGGGCTATTCAGAAGCCAAAAGATCATTTTTTTGTACATTGTTTTTTTAATGTTTCCTTTAGAGAGCTGGGAATAGAAATGATTTCGATTAGAAAGCCTTTATTTATTTTTGGAAATTGAACAAGAACTGCATCTATCTTGGGAACTTTTTGCGGATTATTTAATGCTGGGCAAAATATATAGCTATTTCTTTTGGTAAATTCGTATTGGTAATTTGAAAATGAGATGTCAAGAAAAGTCTATTCTTTAAATTTAGTTTATCCATCTTTAAAAGAAAATTAAACTCAACCATTTTACCGAATCGATAGACTTCTTTTGGAGCATAAAATTTGTATTGTTGATGACTAACAAATATAAACTATGGTAACTAGAATTAACTGCATAGCAGTATACCTAACAATATACAGTAGTATAGTCTAGATTGTATCTGAAAATAATTATGAAAACAAGTATGCTTTACCTTAAACTTTCAAAACTTAATCTATATTTTTGAGTATAAGAGTTTTATAATATTAATAGTTTGTTGAGCAGACTTACTTTGAATCTAGTTTTCAGTGCTCAAAACAACTGCAGTTCCTTTAAATGCATGAACAGAATATTCAGCGATGGACTGAAACCAGCATGTTACAGAAGTATTTGCCACACATTTCCCATCTGTAGTTTCTAAGAAGGGCTAAGGATTATGTAAATTGTTAAATTTTTGCAAAGCTCTTTGACACCCCTCCCCATTTCTCTACTTATCCAGCGGGTTAGCTTGACTGTCACACTTGTTATGTTTTCCATTAAACCAGAAGTATGATATTTAGTATTATCTATTTGTAACCTTAATTTTACCACCTAAATGTAATGTTCACTTGTCGATTCCTACATTAAAATATTTTTGGTATGGAACTTTCCATATTCCATTTTAATATGGAAAGTTCCATTAGCCATACAAATTTTGACATGTTTCAGAGAGGTCAATAAATAAAATATTATGTGGCTATATATTATTTCTCTCAAAGTTTTTAACTTCTCAAGAATCACTGATTTCTTAACTGGGATGTGCTGTATTCATGTCTAAAATGAGCTTAATGATACTGTAAATTTTGTTTTATTTTTTTGGTACTTTTATTACATGACTTTCTGTGAGCTGTATGTTAATGGCAAGGTTCTGTTCTTGGTTAAGAAAAGTAGCATCAAATAGTGTGGGACGTTTTGAGTTTCAGTTCTCTCCCCGCCCCCCCTTCCCAAAGTAGTGGAATCACTGGAGGGTTTTTTTGGCCTTTTTCTTTTCTCATTTACGTCTTCCACTTTTTAATGCTGCTTTATAAAGATAACCAGAGAGGGCTGGGCTAATTCTGGCTCGAGTCCTCAGTAGCTTGTGGGAGAGTGGTTAGAGCAGAGGTTCCAAGGCGGGCCGCCTGTGCTGCAGTCTCGGCTCCACTGCTTCCTATCACTGTGGTCTTGGAAAAGGCACTTCTGTAAGGCTCCGTGTTCCTCTGGAGATTGAGTTAACAGTAGTACTCATAGGACTTCATGAAGATTAAAGGGCATAATCCATTTTAAGCCTTTAGCACAGTGCCTGGAACATAGTAAAACTATTATTTCGGCCAACTATTGTTATTATTAGTCTTAATAGACTATAAACTCCCTTAAGTTTTCTTTTAATTTTAATTGAATAATTATTTATTGGTAATGTCTGCCTTTTCTGCCAGTCTGTGTCTATTATTAAATGCCGTTTTTGGCAGTTGAGAAATACAACAAGATTGCCCTCAGAGTGATCTTATTCGGGGGCAAATCCTTAAATCTAAAACTTGTGTTCATTCATAGCTGTATAAAGTAAAATCATTGAACTAATTGGTGGTAAAAGTATTGAATCTCTTAAAAACCATATAAATAATAAAACATCACATTCTGAAAATCGCA