Transcript asmbl_36180

Sequence
Transcript Sequence for observation asmbl_36180 of TGE0005060:
CCCCGGCTCATCACGTACTTCCGCCTGCCGTTCAAGTTAGTCCTCTAACCAGAGTGAAGCAACTTCCGGCCTTCAGGGCGCCTTCCTCAGTTCTCTTCCGGGTGATGGCGGCCCGGTGCCCCGGATGTAGGCTTGGCGAAAGCATCGCTTCTTCCCCCGCCTGCCTTGGACTCGTAGCTTGGTGAAGGCCCCTCTGTCCAGTTATGTCAAAGAGGAAAGTGACCTTCCAAGGCTTGGGAAATGAGGATGATGAAGACGAAATCAGTGTCCCCAAGAAGAAGCTGGTGGACTCTGTGGCTGGGGCAGGAGGTCCTGGGAGCCGCTTTAAAGGCAAGCACTCTTTGGACAGCGATGAGGAGGATGATGATGATGAGGGGTCCAGCAAATATGACATCCTGGCCTCAGAGGATGTAGAAGGTCAGGAAGCAGCCACACTCCCCAGCGAGGGAGGGGTACGGATCACACCCTTCAACCTACAGGAAGAGATGGAGGAAGGCCACTTTGATGCTGATGGCAACTACTTCTTGAACCGGGAGGCTCAGATACGAGACAGCTGGCTAGACAACATTGACTGGGTTAAGATCAGGGAGCGGCCACCTGATCAGCACCCACCATCAGACTCAGAGGAGGAGGACAGCCTGGGCCAGACACCAATGAGTGCCCAAGCCCTCCTGGAGGGCCTTCTGGAGCTGCTGTTGCCGAGAGAGACAGTGGCTGGGGCGCTGAGGCGCCTAGGGGCCAGAGGAGGAGGCAAAGATGGCAGCAAGGGGCCTAGGCGGCCTAGTTCCCCCCAGCGCTTGGACCGGCTCTCCGGGTTGGCTGACCAAATGGTGGCCCGGGGCAACCTTGGTGTATATCAGGAGACAAGGGAACGGTTGGCCATGCGGCTGAAGGGGTTGGGGTGCCGGACCCAGGGACACCCTGACCCCAAGCCCCCACCTTCTCTGGACATGTTTGCTGAGGAAGTGGCAGAGGGGGAGCTGGAGACCCCAACCCCTGCCCAGAGAGAAGCAGATTCGCCAGGAGATGGTTTGCTGGATGTGATGTGGGAGTATAAGTGGGAGAACACAGGGGATGCTGAGCTGTACGGGCCCTTTACCAGCACCCAGATGCAGACCTGGGTGAATGAAGGCTACTTCCCGGATGGTGTTTATTGTCGGAAGCTGGACCCCCCTGGTGGACAGTTCTACAACTCCAAACGTATTGACTTTGACCTCTACACCTGAGCCTACTGAGGGCTCACTTAGGTGGCCCCTTCTTTCCTGGACTCTGTGAAGGAGGCTCCAGCTGCCTCAGGCAGTGAGGATATTGGGGGCAACTTTTCAGTCAATTTTCCTTTCCCAATAAAAGCCTTTAGTTGTGTGTTAGGGCCTTGGCTTTGCTGATGGCCAGAAGCCAGAGACCACAGCCCCTTTGGACTTGCCTTGGTCTTATAGTGTTTCCTCATGAAGTTCCTCTTTGACAGTTCTGGTCCCTCAAACCATCTCCTGTTTACTGTTCATAAGGGCAGAGCCAGGGCTGTCAGGTGAACAGTGGCCTCCCTTTTTGGATGCAGATCACCATCTAAAAATCTCTTTACTCGTGTGGCATTCTTTGGTATCCTCTGGGCTTCCTGTTTTGCTTTTCTTCGGTCTTTGGTCTTTAGGACCTCAGAGTCTCTCCTTGCAAACAGTGCAGGGTAGAGCCCTAGCAGCGGAGATTTTAGGTCTGATGGGCTGGGGCATCTGTTGGTTTTGAGTAGGAAGCATGGTACTCACTGGCTTCTCATTTTCTCAGGCTCCTTAGGTGAAGTACAGACTCAGTATTGACTCTTGAAGGACTCCAAGGCCACCTGGGCAAACCATCCATAGAATAGGCACAGAGAGGGACAGCACCTCACTGAAGGTTACACAGTTAATCAGAGGACTGGCCCAGACCCAATGGGCTCCCTTCCCAGACCTTTCTTGGTACTAGGTCTTTTCTACCTGGCCTTGAAGCCCTGAGCTTACATTTCCTGAGCTTCCAAAGTGTGCCTGGCACTGAACTAGTGCCTTGAGGAAACTGAGATAACTGGGCTGGTCCCCTTTCAGGAGTTCACAGTCAGGAGTGTAGGTGAAGAGGGAGATAGACAAGTATAATTGTACAGTCTGGACCTACCACTACCACCCTCCCAGCCCATCAGTATGGCTTAAAGCCTCTCCTCACTTGACCAGTTTAGATTTTTCCCTCCACTT