Transcript asmbl_36144

Sequence
Transcript Sequence for observation asmbl_36144 of TGE0005055:
GATCTTGGGTGGATTGGAAGGGACACCTCAGTGGCAGTCAGAAGATCTGGGTTCTTATCTCAGTTCTGGCCCTTGGGTTGCTGTGTGACTTAAAGCAAAGACCTTTCCCTTCTCTCGGTCCTTTCAAATGAGGGGGTTGGGCCCTTCGCCTTATGCATGACCTCTAAATTCTAAAATACTTTGGTTCAATTTTGCTTCTAGGCAAGGTGACCCCATGGCAAGGCGCAAGCCAGAAGGGTCCAGCTTCTACATGAGCCATCTGTCCATGGCTCTGGCCTATTCCTTTACCCCAGATGCCAGTATGCAACCCCACCCTCAGCTGGGCAACACCCAGCAACAAACAGAGTTAGGAAAGGTACAAGAGGCAGGCCTAGTTTAGGGAAGTCGGGTGTAGGGGAGAGCTGGGGACAGGAAATGATCTAAGACCTACTGGGTGTGGGGCAGAGGAGGTAGGGAACATTTGCCCTGACCTCCAGGTAAGGGGCCCTGCTCACTGGGAGACCACAGAAAGACCTAGCAAACTGGTCCTCTCCGCTCTGTTTCCTTTGCCCAGGAACTGACAGGCACCATGCCCTACCAATACCCAGCGCTGACCCCGGAGCAGAAGAAAGAGCTGTCTGACATTGCTCACCGCATTGTGGCTCCGGGCAAAGGCATCTTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACTGAGAACACCGAGGAGAACCGTCGCTTCTACCGCCAGCTGCTGCTGACTGCCGATGACCGTGTGAATCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACGCTTTATCAGAAGGCAGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGTGTGGTACCCCTGGCAGGAACAAATGGCGAGACTACCACCCAAGGATTGGATGGGCTGTCTGAGCGCTGTGCTCAGTACAAGAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAGATTGGGGAACACACTCCCTCAGCCCTTGCCATCATGGAAAATGCCAATGTTTTGGCCCGTTATGCCAGCATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCACGACCTGAAGCGCTGTCAGTATGTAACTGAAAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCATCACATCTACCTGGAAGGCACCTTGCTGAAGCCTAATATGGTCACCCCAGGCCATGCCTGCACCCAGAAATTTTCTAACGAGGAGATTGCCATGGCAACTGTCACAGCGCTGCGCCGCACAGTGCCCCCTGCTGTCACTGGGATCACCTTCTTATCTGGAGGTCAGAGTGAGGAGGAGGCATCCATCAACCTCAATGCAATCAACAAGTGCCCCCTGCTGAAGCCTTGGGCCCTGACCTTTTCCTATGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGTGGAAAGAAGGAGAACCTGAAGGCTGCCCAGGAGGAATATGTCAAGCGAGCACTGGCCAACAGCCTTGCCTGCCAAGGAAAGTACACCCCAAGTGGTCAGGCCGGGGCTGCAGCCAGCCAGTCCCTCTTCATATCTAACCATGCCTACTAAGCGGAGGTGTTCCAAGGCCGCCTCAACACTCCAGGTCCTGCCCGCTTCCACACACCTGAAGAGGGGGCCTCATCCGGGGCTCCAGGCTCCTCTTTCCCATCACTCTTACCTCCCTTGTGACATTGGTGCGTGGTGTTGTCTGTGAATGCTAACTCCATCGCCCTTTCCAGCCCACTGCCAATAAACAACTATTTAAGGGGG