Transcript asmbl_35035

Sequence
Transcript Sequence for observation asmbl_35035 of TGE0005017:
TCTACCCTCAGAACATGAGGGGTAATATTTGCGTGGCTCACAAAGACCAGCAATGGATCACTTGGAGTCCTTCATTGCTGAATGTGATCGGAGAACTGAGCTTGCCAAGAAGCGGCTGGCAGAGACACAGGAGGAGATCAGCGCAGAAGTTTCTGCAAAGGCAGAAAAAGTACATGAGTTGAATGAAGAAATAGGAAAACTTCTTGCTAAAGCTGAGCAGCTGGGAGCTGAAGGAAATGTGGATGAATCCCAGAAGATTCTTATGGAAGTGGAGAAAGTCCGTGCAAAGAAAAAAGAAGCTGAGGAAGAATACAGAAATTCCATGCCTGCATCCAGTTTTCAACAGCAGAAATTGCGTGTCTGTGAAGTCTGCTCTGCTTACCTTGGCCTCCATGACAATGACCGTCGCCTTGCAGACCACTTTGGGGGCAAATTGCACTTGGGGTTCATTCAGATCCGTGAGAAACTGGATCAGTTGAGGAAAACTGTGGCTGAAAAGCAGGAGAAGAGAAATCAGGATCGCTTGAGGAGGAGAGAAGAGAGGGAGCGGGAGGAGCGGCTGAGCAGGAGGTCTGGCTCAAGAACCAGAGAGCGCAGGAGGTCACGTTCCCGGGACCGGCGTCGGAGGCGGTCAAGATCTACCTCCAGAGAGCGACGAAAGTCTTCCCGGTCCCGGTCCCGTGACAGACACCGGCGCCACCGCAGTCGTTCCCGGAGCCACAGCCGGGGCCACCGCCGGGCTTCCAGGGACCGGAGTGCGAAATACAAGTTCTCCAGAGAGCGGGCGTCGAGGGAGGAGTCCTGGGAGCGCGGGCGGAGCGAGCGGGGGGCCACCGACTGGAGGCTCGAGAGCTCCAACGGGAAGACGGCTTCGCGGAGGTCGGAGGAGAAGGAGGCTGGCGAGATCTGAACCCATGCCCAGGCACTGTAAATAGTCTGATAAACGTTCAACATGCCTGAGGTTACTCTTTATATTTGCTGAATACAACTCATCTTTTGTAGTTTAAAATTTCTATTGTTTCAGAGCTAGCTGTGAGTTTCTAGAGATGTACAGTTGCTCCTGTGTTCTGGGGTTATGTCGAGTAGGAATAAATAAATCTGACAAGACTGCCTCCTGA