Transcript asmbl_34561

Sequence
Transcript Sequence for observation asmbl_34561 of TGE0012484:
GAATTATGCTCCGAGGACCTCTTCAAAAGAAATTACTTTCCAGCTCGATTTCATGCTGCCACTTTAATTTCGTCACAGTGGTGCATGGCAGGTCAAGGGCCCATCAGCCATGGAGGTGCCAGTCAGATGCAGCCGCAGCCACAGCCGCCACAGAAACAGCCCAACGTGCCAGAAGCCCAAGTCCTCAAGTTCAACCAGGGAAGAGGACGCCGAAAACTGGAATATTGATGCTAAACATGGGAGGCCCCGAAACCCTTGGAGAAGTTTACAACTTTCTCCTGAGGCTCTTCTTGGACCGGGACCTCATGACGCTGCCTATTCAAGATAAGCTGGCACCAATCATCGCCAAACGCCGAACCCCCAGAATTCAGGAGCAGTACCGCAGGATCGGAGGCGGATCCCCCATCAAGATGTGGACTTCCAAGCAAGGAGAAGGCATGGTGAAGCTGCTGGATGAGTTGTCCCCGCACACAGCCCCTCACAAATACTATATTGGATTCCGGTATGTCCATCCTTTAACAGAAGAAGCAATTGAAGAGATGGAGAGAGACGGGCTTGAAAGGGCTATTGCTTTCACGCAGTACCCACAGTACAGCTGCTCTACCACAGGCAGCAGCTTAAATGCCATTTACAGATATTATAATGAAAAGGGAAAGAAGCCTATGATGAAGTGGAGCACAATTGACAGGTGGCCCACACATCCCCTCCTCATTCAGTGCTTTGCAGACCACATTCTGAAAGAACTGGACCATTTTCCACTGGAGAAGAGAAGCGAGGTGGTCATTCTTTTTTCGGCTCACTCACTGCCAATGTCCGTGGTCAACAGAGGGGACCCCTATCCTCAGGAGGTGGGCGCCACCGTCCAGAGAGTCATGGAGAAGCTGAATTACTCCAACCCCTACCGACTGGTCTGGCAGTCCAAGGTTGGTCCAATGCCCTGGCTGGGTCCTCAGACAGACGAGACTATCAAAGGGCTTTGCGAGAGGGGCTGGAAGAACATTCTTTTGGTTCCAATAGCATTTACCAGCGATCACATTGA